AW523365 Marker Search Result - Rat Genome Database

AW523365 Marker Search Result - Rat Genome Database

Submit Data | Help | Video Tutorials | News | Publications | Download | REST API | Citing RGD | Contact

Advanced Search (OLGA)

General

Marker: AW523365

Symbol:

AW523365

Previously known as:

RGD ID:

5029699

Expected Size:

133 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
GRCr8	11	44,002,392 - 44,002,525 (+)	Marker Load Pipeline
mRatBN7.2	11	30,516,321 - 30,516,454 (+)	MAPPER	mRatBN7.2
Rnor_6.0	11	31,430,320 - 31,430,452	NCBI	Rnor6.0
Rnor_5.0	11	35,039,366 - 35,039,498	UniSTS	Rnor5.0
RGSC_v3.4	11	31,246,222 - 31,246,354	UniSTS	RGSC3.4
Celera	11	30,183,341 - 30,183,473	UniSTS
RH 3.4 Map	11	180.8	UniSTS
Cytogenetic Map	11	q11	UniSTS

Is Marker For:

Genes: Olig1

#	Reference Title	Reference Citation
1.	UniSTS Pipeline	RGD automated pipelines


Forward Primer	AAACGCCAGTTAAATTCGGCTA
Reverse Primer	CTGCGTCTTGGCTTGTGATTAG

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
621129	Olig1	oligodendrocyte transcription factor 1	11	30514379	30516521	Rat


RefSeq Transcripts	NM_021770	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC112633	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AF151367	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1300147	Bp187	Blood pressure QTL 187	3.67		arterial blood pressure trait (VT:2000000)	blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)	11	1	69446234	Rat
724554	Iddm17	Insulin dependent diabetes mellitus QTL 17		0.001	blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	11	18976208	86241447	Rat
1598842	Glom10	Glomerulus QTL 10	3.4		kidney glomerulus morphology trait (VT:0005325)	index of glomerular damage (CMO:0001135)	11	1	35331169	Rat
8694376	Bw156	Body weight QTL 156	2.25	0.001	body lean mass (VT:0010483)	lean tissue morphological measurement (CMO:0002184)	11	23280456	68280456	Rat
10755497	Bp388	Blood pressure QTL 388	2.76		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	11	19456205	76331918	Rat
724517	Uae18	Urinary albumin excretion QTL 18	3.7		urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	11	16472047	44285911	Rat
10058952	Gmadr6	Adrenal mass QTL 6	2.29	0.0072	adrenal gland mass (VT:0010420)	both adrenal glands wet weight to body weight ratio (CMO:0002411)	11	22959403	67959403	Rat
1300130	Rf20	Renal function QTL 20	4.44		kidney glomerulus integrity trait (VT:0010546)	kidney glomerulus diameter (CMO:0001166)	11	29528418	60324829	Rat
1558659	Tescar1	Testicular tumor resistance QTL 1	3.9		testis integrity trait (VT:0010572)	percentage of study population developing testis tumors during a period of time (CMO:0001261)	11	1041931	66113562	Rat
724563	Uae10	Urinary albumin excretion QTL 10	6		urine albumin amount (VT:0002871)	urine albumin level (CMO:0000130)	11	27672410	82846715	Rat
9589032	Epfw10	Epididymal fat weight QTL 10	9.29	0.001	epididymal fat pad mass (VT:0010421)	epididymal fat pad weight to body weight ratio (CMO:0000658)	11	23280456	68280456	Rat
9590313	Scort20	Serum corticosterone level QTL 20	6.51	0.001	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	11	23280456	68280456	Rat
8694424	Bw162	Body weight QTL 162	3.8	0.001	body lean mass (VT:0010483)	lean tissue morphological measurement (CMO:0002184)	11	23280456	68280456	Rat
1300110	Stl7	Serum triglyceride level QTL 7	4.64		blood triglyceride amount (VT:0002644)	plasma triglyceride level (CMO:0000548)	11	29528418	82566702	Rat
1641927	Alcrsp10	Alcohol response QTL 10			alcohol metabolism trait (VT:0015089)	blood ethanol level (CMO:0000535)	11	8436674	53436674	Rat

Database	Acc Id	Source(s)
NCBI Gene	60394	UniSTS