RH71142 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH71142

Symbol: RH71142
Previously known as:
RGD ID: 5028348
Expected Size: 184 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21112,532,720 - 12,532,904 (+)MAPPERmRatBN7.2
Rnor_6.01111,066,636 - 11,066,819NCBIRnor6.0
Rnor_5.01114,737,001 - 14,737,184UniSTSRnor5.0
RGSC_v3.41112,666,161 - 12,666,344UniSTSRGSC3.4
Celera1112,558,525 - 12,558,708UniSTS
Cytogenetic Map11p11UniSTS
Is Marker For: Genes:   Robo2  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AAGAAAGAGTTAAGGTGGGTGG
Reverse Primer TCTGAAGGACCATCAGGTCC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
620167Robo2roundabout guidance receptor 2111252894914096726Rat

Nucleotide Sequences
RefSeq Transcripts NM_032106 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1300147Bp187Blood pressure QTL 1873.67arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)11169446234Rat
1598842Glom10Glomerulus QTL 103.4kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)11135331169Rat
1558659Tescar1Testicular tumor resistance QTL 13.9testis integrity trait (VT:0010572)percentage of study population developing testis tumors during a period of time (CMO:0001261)11104193166113562Rat
634341Bw121Body weight QTL 1213.56abdominal fat pad mass (VT:1000711)abdominal fat pad weight (CMO:0000088)11121836709Rat
1641927Alcrsp10Alcohol response QTL 10alcohol metabolism trait (VT:0015089)blood ethanol level (CMO:0000535)11843667453436674Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 84409 UniSTS