D14Got10 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D14Got10

Symbol: D14Got10
Previously known as: oxsts325; OT66.16; 
RGD ID: 45146
Expected Size: 172 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2145,889,548 - 5,889,720 (+)MAPPERmRatBN7.2
Rnor_6.0147,251,239 - 7,251,410NCBIRnor6.0
Rnor_5.0147,241,163 - 7,241,334UniSTSRnor5.0
RGSC_v3.4147,040,107 - 7,040,278RGDRGSC3.4
RGSC_v3.4147,040,107 - 7,040,278UniSTSRGSC3.4
RGSC_v3.1147,040,107 - 7,040,278RGD
Celera146,028,327 - 6,028,498UniSTS
RH 3.4 Map14120.7RGD
RH 3.4 Map14120.7UniSTS
RH 2.0 Map14122.3RGD
Cytogenetic Map14p22UniSTS
Is Marker For: Genes:   Aff1  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer CGATCGAGGGTCTCTCACATT
Reverse Primer GAATGAGTTTTAATTTGCTTCCTGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1307940Aff1ALF transcription elongation factor 11458611886024196Rat

Nucleotide Sequences
GenBank Nucleotide AU026073 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH618008.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1300114Srn2Serum renin concentration QTL 23.27blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)14381307421217635Rat
70195Mcs8Mammary carcinoma susceptibility QTL 84.28mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)14381307424531477Rat
2293089Iddm31Insulin dependent diabetes mellitus QTL 314.7blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)14381307418274691Rat
2300183Bmd60Bone mineral density QTL 605.70.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)14126541967Rat
724541Niddm53Non-insulin dependent diabetes mellitus QTL 530.001blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1438130749088978Rat
1331740Bw26Body weight QTL 263.028body mass (VT:0001259)body weight (CMO:0000012)14381307430767156Rat
634352Apr6Acute phase response QTL 63.7blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)14141131407Rat
619619Rf4Renal disease susceptibility QTL 44.10.002urine total protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)14132754612Rat
71115Niddm15Non-insulin dependent diabetes mellitus QTL 154.8blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)14121760611030812Rat
2300159Bmd61Bone mineral density QTL 615.30.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)14126541967Rat
70204Niddm20Non-insulin dependent diabetes mellitus QTL 205.10.000008blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)14121760616960180Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 305152 UniSTS