D10Got52 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D10Got52

Symbol: D10Got52
Previously known as: oxsts191; OT24.16; 
RGD ID: 44727
Expected Size: 115 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr81031,774,263 - 31,774,378 (+)Marker Load Pipeline
mRatBN7.21031,273,026 - 31,273,141 (+)MAPPERmRatBN7.2
Rnor_6.01031,967,842 - 31,967,956NCBIRnor6.0
Rnor_5.01031,787,577 - 31,787,691UniSTSRnor5.0
RGSC_v3.41031,998,609 - 31,998,724RGDRGSC3.4
RGSC_v3.41031,998,610 - 31,998,724UniSTSRGSC3.4
RGSC_v3.11031,999,658 - 31,999,773RGD
Celera1030,712,869 - 30,712,983UniSTS
RH 2.0 Map10376.5RGD


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. UniSTS Pipeline RGD automated pipelines
3. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
4. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer TGCTTATCAGATTCACCAGCA
Reverse Primer CCTGTGTGAGTCATCACTCGG
 

Region

Nucleotide Sequences
GenBank Nucleotide AU025330 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
631564Apr3Acute phase response QTL 33.9blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)101577675460776754Rat
1298069Bp168Blood pressure QTL 1685.5blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)102702353598502431Rat
2293669Bmd33Bone mineral density QTL 334.50.0001femur strength trait (VT:0010010)femoral neck polar moment of inertia (CMO:0001670)102744378772443787Rat
631554Bp133Blood pressure QTL 1330.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)10125055464349221Rat
61325Aia5Adjuvant induced arthritis QTL 50.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023948641107713808Rat
2293679Bmd30Bone mineral density QTL 303.50.0001femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)102744378772443787Rat
1578761Stresp21Stress response QTL 213.3thymus mass (VT:0004954)thymus wet weight (CMO:0000855)10687714251877142Rat
2293680Bss40Bone structure and strength QTL 405.660.0001femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)10135730538Rat
2298544Neuinf9Neuroinflammation QTL 94.6nervous system integrity trait (VT:0010566)spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)101993920764939207Rat
61332Eau3Experimental allergic uveoretinitis QTL 30.004uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)101803578263035782Rat
10401803Kidm50Kidney mass QTL 50kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)1092219745922197Rat
2317754Glom25Glomerulus QTL 253.5urine protein amount (VT:0005160)urine protein level (CMO:0000591)10210370847103708Rat
1598852Anxrr19Anxiety related response QTL 195.07body movement coordination trait (VT:0005424)number of rearing movements in an experimental apparatus (CMO:0001752)101866841963668419Rat
1581497Esta1Estrogen-induced thymic atrophy QTL 1thymus mass (VT:0004954)thymus wet weight (CMO:0000855)102183375861843633Rat
2313095Bss62Bone structure and strength QTL 621.50.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)10589381150893811Rat
724527Bp148Blood pressure QTL 1480.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)102895035373950353Rat
1331762Rf40Renal function QTL 403.873kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)102980091064653589Rat
2300171Bmd58Bone mineral density QTL 584.90.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)102744378772443787Rat
61354Pia10Pristane induced arthritis QTL 100.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023948641107713808Rat
2301967Cm73Cardiac mass QTL 734.55heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)101499153586964295Rat
2313104Bss61Bone structure and strength QTL 610.90.0001tibia area (VT:1000281)tibia midshaft cross-sectional area (CMO:0001717)10589381150893811Rat
2316949Gluco60Glucose level QTL 603.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1014991535107556066Rat
2293652Bmd22Bone mineral density QTL 224.90.0001femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)102744378772443787Rat
724556Pur2Proteinuria QTL 25.5urine protein amount (VT:0005160)urine protein level (CMO:0000591)102293137391127454Rat
8662860Vetf10Vascular elastic tissue fragility QTL 10artery integrity trait (VT:0010639)number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562)10666092373950353Rat
2313066Bss63Bone structure and strength QTL 631.40.0001tibia strength trait (VT:1000284)bone polar moment of inertia (CMO:0001558)10589381150893811Rat
2313064Bmd71Bone mineral density QTL 710.90.0001tibia mineral mass (VT:1000283)compact volumetric bone mineral density (CMO:0001730)10589381150893811Rat
70223Bp57Blood pressure QTL 575arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)101465354159653541Rat
1354587Kidm21Kidney mass QTL 213.3kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)101553301273695498Rat
634329Pia15Pristane induced arthritis QTL 153.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)102466212373695339Rat
70224Eae3Experimental allergic encephalomyelitis QTL 34.1nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)102702353561843633Rat
2313081Bss64Bone structure and strength QTL 641.30.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)10589381150893811Rat
1331791Cm31Cardiac mass QTL 313.84606heart mass (VT:0007028)heart wet weight (CMO:0000069)102980091091417879Rat
2298495Eae23Experimental allergic encephalomyelitis QTL 2316.93nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis duration (CMO:0001424)101617552561175525Rat
2313087Bmd80Bone mineral density QTL 803.20.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)102011061465110614Rat
634327Hc4Hypercalciuria QTL 42.4urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)10138832698Rat
631531Iresp2Immunoglobin response QTL26.3blood immunoglobulin E amount (VT:0002492)serum immunoglobulin E level (CMO:0002101)102342212132490778Rat
631530Tls3T-lymphoma susceptibility QTL 300.0001thymus integrity trait (VT:0010555)percentage of study population developing T-cell lymphomas during a period of time (CMO:0001911)102758722696099902Rat
2289985Bp305Blood pressure QTL 305arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)102907697874076978Rat
631660Hcar1Hepatocarcinoma resistance QTL 13.40.0001liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)10666111835509383Rat
631532Cm50Cardiac mass QTL 506.6heart mass (VT:0007028)calculated heart weight (CMO:0000073)101803578263035782Rat
631267Cia20Collagen induced arthritis QTL 203.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023948641107713808Rat
2293705Bmd25Bone mineral density QTL 257.10.0001femur mineral mass (VT:0010011)compact volumetric bone mineral density (CMO:0001730)102744378772443787Rat
1600371Mcs21Mammary carcinoma susceptibility QTL 213mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)102937704652699134Rat
631268Cia21Collagen induced arthritis QTL 213.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1014991535107713808Rat
1576311Pia26Pristane induced arthritis QTL 26joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)103112911376129113Rat
61427Cia16Collagen induced arthritis QTL 163.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)10686461896620484Rat
2313055Bw96Body weight QTL 963.60.0001body mass (VT:0001259)body weight (CMO:0000012)102011061465110614Rat
631542Bp82Blood pressure QTL 826.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)102702353599451848Rat


Additional Information