D9Wox2 Marker Search Result - Rat Genome Database

Advanced Search (OLGA)

General

Marker: D9Wox2

Symbol:

D9Wox2

Previously known as:

oxsts5304; RCA19.03;

RGD ID:

44649

Expected Size:

172 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
GRCr8	9	95,234,996 - 95,235,168 (+)	Marker Load Pipeline
mRatBN7.2	9	87,787,095 - 87,787,267 (+)	MAPPER	mRatBN7.2
Rnor_6.0	9	94,211,301 - 94,211,472	NCBI	Rnor6.0
Rnor_5.0	9	93,936,502 - 93,936,673	UniSTS	Rnor5.0
RGSC_v3.4	9	85,906,569 - 85,906,741	RGD	RGSC3.4
RGSC_v3.4	9	85,906,570 - 85,906,741	UniSTS	RGSC3.4
RGSC_v3.1	9	86,089,988 - 86,090,160	RGD
Celera	9	85,200,788 - 85,200,959	UniSTS
RH 2.0 Map	9	849.5	RGD
Cytogenetic Map	9		RGD

Annotation

References - curated

#	Reference Title	Reference Citation
1.	Data downloaded from Wellcome Trust, University of Oxford	Data downloaded from Wellcome Trust, University of Oxford
2.	UniSTS Pipeline	RGD automated pipelines
3.	RH Map Project	RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
4.	A high density integrated genetic linkage and radiation hybrid map of the laboratory rat	Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
5.	Electronic Submission of SSLP Data Sets	Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence


Forward Primer	CTCCTGCCTGGGTAACCTG
Reverse Primer	CCTCTTCTGGGCTTCTTAGG

Region

Nucleotide Sequences


GenBank Nucleotide	AJ230895	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (GRCr8)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
631656	Bp108	Blood pressure QTL 108	5.97	0.0001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	9	56047863	101047863	Rat
1582203	Gluco19	Glucose level QTL 19	3.3	0.001	blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	9	63376862	108376862	Rat
8662828	Vetf6	Vascular elastic tissue fragility QTL 6	3.9		artery integrity trait (VT:0010639)	patent ductus arteriosus score (CMO:0002566)	9	44458256	99506504	Rat
724515	Uae16	Urinary albumin excretion QTL 16	8		urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	9	65657365	108376720	Rat
724547	Cm21	Cardiac mass QTL 21	2.7		heart mass (VT:0007028)	calculated heart weight (CMO:0000073)	9	86720043	110356905	Rat
2303178	Bp334	Blood pressure QTL 334	3.7	0.01	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	9	86720043	121768150	Rat
724544	Uae9	Urinary albumin excretion QTL 9	4.5		urine albumin amount (VT:0002871)	urine albumin level (CMO:0000130)	9	64220169	109220169	Rat
2290450	Scl57	Serum cholesterol level QTL 57	4.15		blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	9	44458256	121768150	Rat
1578760	Cm53	Cardiac mass QTL 53	3.3	0.0001	heart mass (VT:0007028)	heart wet weight (CMO:0000069)	9	64220169	109220169	Rat
1581580	Uae34	Urinary albumin excretion QTL 34			urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	9	64220169	109220169	Rat
1300134	Bp185	Blood pressure QTL 185	3.73		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	9	68875497	121768150	Rat
1354626	Bvd1	Brain ventricular dilatation QTL 1	3.73	0.001	brain ventricle morphology trait (VT:0000822)	hydrocephalus severity score (CMO:0001881)	9	83161999	118999486	Rat
4889852	Pur26	Proteinuria QTL 26	15	0.001	urine total protein amount (VT:0000032)	urine total protein excretion rate (CMO:0000756)	9	85262459	109044727	Rat
7794784	Mcs31	Mammary carcinoma susceptibility QTL 31	2.98		mammary gland integrity trait (VT:0010552)	mammary tumor incidence/prevalence measurement (CMO:0000946)	9	85262459	118999486	Rat
731164	Uae25	Urinary albumin excretion QTL 25	3.5	0.0001	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	9	48718864	108376862	Rat
4889943	Bss90	Bone structure and strength QTL 90	4.1		tibia area (VT:1000281)	tibia-fibula cortical bone endosteal cross-sectional area (CMO:0001722)	9	54506504	99506504	Rat
1578757	Pur6	Proteinuria QTL 6	3.3	0.005	urine total protein amount (VT:0000032)	urine total protein excretion rate (CMO:0000756)	9	64220169	109220169	Rat

Additional Information

RGD Curation Notes

Note Type	Note	Reference

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: D9Wox2