D1Got169 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D1Got169

Symbol: D1Got169
Previously known as: oxsts53; OT92.32; 
RGD ID: 43354
Expected Size: 163 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr81193,249,978 - 193,250,141 (+)Marker Load Pipeline
mRatBN7.21183,819,623 - 183,819,785 (+)MAPPERmRatBN7.2
Rnor_6.01202,410,715 - 202,410,876NCBIRnor6.0
Rnor_5.01209,434,358 - 209,434,519UniSTSRnor5.0
RGSC_v3.41188,506,527 - 188,506,688UniSTSRGSC3.4
RGSC_v3.41188,506,527 - 188,506,688RGDRGSC3.4
RGSC_v3.11188,656,408 - 188,656,569RGD
Celera1181,461,247 - 181,461,408UniSTS
RH 3.4 Map11384.29UniSTS
RH 3.4 Map11384.29RGD
RH 2.0 Map1983.2RGD
Cytogenetic Map1q37UniSTS
Is Marker For: Genes:   Plpp4  




#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8


 
Forward Primer CGATCTACCCTTCAAGAGGGA
Reverse Primer ACCTGTAGCATAACATGGTTTCC
 
GenBank Nucleotide AU026658 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 80 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
1578778Pur4Proteinuria QTL 43.30.003urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)1150700247252085048Rat
1354646Kidm18Kidney mass QTL 185.7kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1151162512256448636Rat
1578780Cm52Cardiac mass QTL 523.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)181591954219808434Rat
1354652Kidm20Kidney mass QTL 204.3kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1177227632256448636Rat
2302378Insul11Insulin level QTL 113.25blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1144267353251128347Rat
1354653Despr9Despair related QTL 90.00019locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1167909849212909849Rat
2293673Bss27Bone structure and strength QTL 2718.630.0001femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)1171629477216629477Rat
2293677Bss41Bone structure and strength QTL 419.380.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra cross-sectional area (CMO:0001689)1171629477216629477Rat
1302787Stl25Serum triglyceride level QTL 252.70.0073blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)1180359209210702199Rat
70160Bw18Body weight QTL 185.7body mass (VT:0001259)body weight (CMO:0000012)1144267353196383668Rat

1 to 10 of 80 rows


Database
Acc Id
Source(s)
NCBI Gene 309014 UniSTS