Symbol:
Exoc3
Name:
exocyst complex component 3
RGD ID:
621790
Description:
Predicted to enable SNARE binding activity. Predicted to be involved in exocyst localization and exocytosis. Is active in presynaptic membrane. Orthologous to human EXOC3 (exocyst complex component 3); PARTICIPATES IN E-cadherin signaling pathway; insulin signaling pathway; INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,4-dinitrotoluene; 3,3',4,4',5-pentachlorobiphenyl.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
exocyst complex component Sec6; rSec6; Sec6; SEC6-like 1; SEC6-like 1 (S. cerevisiae); Sec6l1
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
EXOC3 (exocyst complex component 3) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):
Exoc3 (exocyst complex component 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Exoc3 (exocyst complex component 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
EXOC3 (exocyst complex component 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
EXOC3 (exocyst complex component 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Exoc3 (exocyst complex component 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
EXOC3 (exocyst complex component 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
EXOC3 (exocyst complex component 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Exoc3 (exocyst complex component 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Mus musculus (house mouse):
Exoc3 (exocyst complex component 3)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Homo sapiens (human):
EXOC3 (exocyst complex component 3)
Alliance
DIOPT (HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
exoc3 (exocyst complex component 3)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Saccharomyces cerevisiae (baker's yeast):
SEC6
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Drosophila melanogaster (fruit fly):
Sec6
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Caenorhabditis elegans (roundworm):
sec-6
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
exoc3
Alliance
DIOPT (Ensembl Compara|OMA|OrthoFinder|PANTHER|PhylomeDB)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 30,919,871 - 30,950,624 (+) NCBI GRCr8 mRatBN7.2 1 29,091,298 - 29,122,056 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 29,091,294 - 29,122,045 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 28,893,113 - 28,923,914 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 34,892,975 - 34,923,773 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 29,093,734 - 29,124,536 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 31,700,953 - 31,731,726 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 31,700,953 - 31,731,815 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 33,126,575 - 33,159,109 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 1 29,897,536 - 29,928,281 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 1 29,902,027 - 29,931,141 (+) NCBI Celera 1 27,743,063 - 27,773,955 (+) NCBI Celera Cytogenetic Map 1 p11 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Exoc3 Rat 1,2-dichloroethane increases expression ISO Exoc3 (Mus musculus) 6480464 ethylene dichloride results in increased expression of EXOC3 mRNA CTD PMID:28960355 Exoc3 Rat 1,2-dimethylhydrazine affects expression ISO Exoc3 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine affects the expression of EXOC3 mRNA CTD PMID:22206623 Exoc3 Rat 2,2',4,4'-Tetrabromodiphenyl ether decreases expression ISO EXOC3 (Homo sapiens) 6480464 2 more ... CTD PMID:31675489 Exoc3 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Exoc3 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin binds to AHR protein] which results in increased expression of EXOC3 mRNA and [TIPARP gene mutant form results in increased susceptibility to Tetrachlorodibenzodioxin] which results in increased expression of EXOC3 mRNA CTD PMID:16214954 and PMID:25975270 Exoc3 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO Exoc3 (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in increased expression of EXOC3 mRNA CTD PMID:18796159 more ... Exoc3 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Exoc3 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of EXOC3 mRNA CTD PMID:21570461 and PMID:26377647 Exoc3 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of EXOC3 mRNA and Tetrachlorodibenzodioxin results in increased expression of SEC6 mRNA CTD PMID:16054898 more ... Exoc3 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of EXOC3 mRNA CTD PMID:22298810 Exoc3 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO Exoc3 (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in decreased expression of EXOC3 mRNA CTD PMID:20159946 Exoc3 Rat 2,4,6-tribromophenol decreases expression ISO EXOC3 (Homo sapiens) 6480464 2 more ... CTD PMID:31675489 Exoc3 Rat 2,4-dinitrotoluene affects expression EXP 6480464 2 and 4-dinitrotoluene affects the expression of EXOC3 mRNA CTD PMID:21346803 Exoc3 Rat 3,3',4,4',5-pentachlorobiphenyl increases expression EXP 6480464 3 more ... CTD PMID:20959002 Exoc3 Rat 3,3',5,5'-tetrabromobisphenol A decreases expression ISO EXOC3 (Homo sapiens) 6480464 tetrabromobisphenol A results in decreased expression of EXOC3 protein CTD PMID:31675489 Exoc3 Rat 3-chloropropane-1,2-diol increases expression EXP 6480464 alpha-Chlorohydrin results in increased expression of EXOC3 protein CTD PMID:34915118 Exoc3 Rat 3-isobutyl-1-methyl-7H-xanthine multiple interactions ISO EXOC3 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in decreased expression of EXOC3 mRNA and [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] results in decreased expression of EXOC3 mRNA CTD PMID:28628672 Exoc3 Rat 3H-1,2-dithiole-3-thione decreases expression EXP 6480464 1 and 2-dithiol-3-thione results in decreased expression of EXOC3 mRNA CTD PMID:19162173 Exoc3 Rat 4,4'-diaminodiphenylmethane decreases expression ISO Exoc3 (Mus musculus) 6480464 4 and 4'-diaminodiphenylmethane results in decreased expression of EXOC3 mRNA CTD PMID:18648102 Exoc3 Rat 4,4'-sulfonyldiphenol multiple interactions ISO EXOC3 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] results in decreased expression of EXOC3 mRNA CTD PMID:28628672 Exoc3 Rat acrolein multiple interactions ISO EXOC3 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased oxidation of EXOC3 mRNA and [Air Pollutants results in increased abundance of [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone]] which results in increased oxidation of EXOC3 mRNA CTD PMID:32699268 Exoc3 Rat acrylamide decreases expression ISO EXOC3 (Homo sapiens) 6480464 Acrylamide results in decreased expression of EXOC3 mRNA CTD PMID:32763439 Exoc3 Rat aflatoxin B1 decreases expression ISO Exoc3 (Mus musculus) 6480464 Aflatoxin B1 results in decreased expression of EXOC3 mRNA CTD PMID:19770486 Exoc3 Rat all-trans-retinoic acid increases expression ISO EXOC3 (Homo sapiens) 6480464 Tretinoin results in increased expression of EXOC3 mRNA CTD PMID:15498508 and PMID:33167477 Exoc3 Rat allethrin multiple interactions EXP 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in decreased expression of EXOC3 protein CTD PMID:34896426 Exoc3 Rat alpha-pinene multiple interactions ISO EXOC3 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased oxidation of EXOC3 mRNA and [Air Pollutants results in increased abundance of [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone]] which results in increased oxidation of EXOC3 mRNA CTD PMID:32699268 Exoc3 Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of EXOC3 mRNA CTD PMID:16483693 Exoc3 Rat Aroclor 1254 increases expression EXP 6480464 Chlorodiphenyl (54% Chlorine) results in increased expression of EXOC3 mRNA CTD PMID:18178546 Exoc3 Rat arsane affects methylation ISO EXOC3 (Homo sapiens) 6480464 Arsenic affects the methylation of EXOC3 gene CTD PMID:25304211 Exoc3 Rat arsenic atom affects methylation ISO EXOC3 (Homo sapiens) 6480464 Arsenic affects the methylation of EXOC3 gene CTD PMID:25304211 Exoc3 Rat benzo[a]pyrene increases expression ISO Exoc3 (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of EXOC3 mRNA CTD PMID:19770486 more ... Exoc3 Rat benzo[a]pyrene increases methylation ISO EXOC3 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of EXOC3 5' UTR CTD PMID:27901495 Exoc3 Rat benzo[a]pyrene decreases methylation ISO EXOC3 (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased methylation of EXOC3 promoter CTD PMID:27901495 Exoc3 Rat beta-lapachone decreases expression ISO EXOC3 (Homo sapiens) 6480464 beta-lapachone results in decreased expression of EXOC3 mRNA CTD PMID:38218311 Exoc3 Rat beta-lapachone increases expression ISO EXOC3 (Homo sapiens) 6480464 beta-lapachone results in increased expression of EXOC3 mRNA CTD PMID:38218311 Exoc3 Rat bisphenol A increases expression ISO Exoc3 (Mus musculus) 6480464 bisphenol A results in increased expression of EXOC3 mRNA CTD PMID:26063408 Exoc3 Rat bisphenol A decreases expression ISO EXOC3 (Homo sapiens) 6480464 bisphenol A results in decreased expression of EXOC3 protein CTD PMID:31675489 Exoc3 Rat bisphenol A multiple interactions ISO EXOC3 (Homo sapiens) 6480464 [bisphenol A co-treated with Fulvestrant] results in decreased methylation of EXOC3 gene CTD PMID:31601247 Exoc3 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of EXOC3 mRNA CTD PMID:25181051 and PMID:30816183 Exoc3 Rat bisphenol F multiple interactions ISO EXOC3 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in decreased expression of EXOC3 mRNA CTD PMID:28628672 Exoc3 Rat butan-1-ol multiple interactions ISO EXOC3 (Homo sapiens) 6480464 [[Gasoline co-treated with 1-Butanol] results in increased abundance of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of EXOC3 mRNA CTD PMID:29432896 Exoc3 Rat cadmium atom increases expression ISO EXOC3 (Homo sapiens) 6480464 Cadmium results in increased expression of EXOC3 mRNA CTD PMID:24376830 Exoc3 Rat cadmium dichloride decreases expression ISO EXOC3 (Homo sapiens) 6480464 Cadmium Chloride results in decreased expression of EXOC3 mRNA CTD PMID:38568856 Exoc3 Rat caffeine decreases phosphorylation ISO EXOC3 (Homo sapiens) 6480464 Caffeine results in decreased phosphorylation of EXOC3 protein CTD PMID:35688186 Exoc3 Rat carbon nanotube decreases expression ISO Exoc3 (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25554681 Exoc3 Rat chlorpyrifos decreases expression ISO Exoc3 (Mus musculus) 6480464 Chlorpyrifos results in decreased expression of EXOC3 mRNA CTD PMID:37019170 Exoc3 Rat cisplatin multiple interactions ISO EXOC3 (Homo sapiens) 6480464 [Piroxicam co-treated with Cisplatin] results in increased expression of EXOC3 mRNA CTD PMID:21858171 Exoc3 Rat copper atom multiple interactions ISO EXOC3 (Homo sapiens) 6480464 [NSC 689534 binds to Copper] which results in increased expression of EXOC3 mRNA CTD PMID:20971185 Exoc3 Rat copper(0) multiple interactions ISO EXOC3 (Homo sapiens) 6480464 [NSC 689534 binds to Copper] which results in increased expression of EXOC3 mRNA CTD PMID:20971185 Exoc3 Rat cyhalothrin multiple interactions EXP 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in decreased expression of EXOC3 protein CTD PMID:34896426 Exoc3 Rat cypermethrin multiple interactions EXP 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in decreased expression of EXOC3 protein CTD PMID:34896426 Exoc3 Rat dexamethasone multiple interactions ISO EXOC3 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in decreased expression of EXOC3 mRNA and [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] results in decreased expression of EXOC3 mRNA CTD PMID:28628672 Exoc3 Rat dibutyl phthalate decreases expression ISO Exoc3 (Mus musculus) 6480464 Dibutyl Phthalate results in decreased expression of EXOC3 mRNA CTD PMID:21266533 Exoc3 Rat diuron increases expression EXP 6480464 Diuron results in increased expression of EXOC3 mRNA CTD PMID:21551480 Exoc3 Rat elemental selenium increases expression ISO EXOC3 (Homo sapiens) 6480464 Selenium results in increased expression of SEC6 mRNA CTD PMID:19244175 Exoc3 Rat ethanol multiple interactions ISO EXOC3 (Homo sapiens) 6480464 [[Gasoline co-treated with Ethanol] results in increased abundance of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of EXOC3 mRNA CTD PMID:29432896 Exoc3 Rat ethanol affects splicing ISO Exoc3 (Mus musculus) 6480464 Ethanol affects the splicing of EXOC3 mRNA CTD PMID:30319688 Exoc3 Rat fenvalerate multiple interactions EXP 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in decreased expression of EXOC3 protein CTD PMID:34896426 Exoc3 Rat finasteride increases expression EXP 6480464 Finasteride results in increased expression of EXOC3 mRNA CTD PMID:24136188 Exoc3 Rat flutamide increases expression EXP 6480464 Flutamide results in increased expression of EXOC3 mRNA CTD PMID:24136188 Exoc3 Rat formaldehyde increases expression ISO EXOC3 (Homo sapiens) 6480464 Formaldehyde results in increased expression of EXOC3 mRNA CTD PMID:23649840 Exoc3 Rat fulvestrant multiple interactions ISO EXOC3 (Homo sapiens) 6480464 [bisphenol A co-treated with Fulvestrant] results in decreased methylation of EXOC3 gene CTD PMID:31601247 Exoc3 Rat gentamycin increases expression ISO EXOC3 (Homo sapiens) 6480464 Gentamicins results in increased expression of EXOC3 mRNA CTD PMID:29992668 Exoc3 Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of EXOC3 mRNA CTD PMID:33387578 Exoc3 Rat indometacin multiple interactions ISO EXOC3 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in decreased expression of EXOC3 mRNA and [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] results in decreased expression of EXOC3 mRNA CTD PMID:28628672 Exoc3 Rat ivermectin decreases expression ISO EXOC3 (Homo sapiens) 6480464 Ivermectin results in decreased expression of EXOC3 protein CTD PMID:32959892 Exoc3 Rat leflunomide increases expression EXP 6480464 leflunomide results in increased expression of EXOC3 mRNA CTD PMID:24136188 Exoc3 Rat methyl methanesulfonate increases expression ISO EXOC3 (Homo sapiens) 6480464 Methyl Methanesulfonate results in increased expression of EXOC3 mRNA CTD PMID:23649840 Exoc3 Rat Nor-9-carboxy-delta9-THC multiple interactions ISO EXOC3 (Homo sapiens) 6480464 [Cannabinoids results in increased abundance of 11-nor-delta(9)-tetrahydrocannabinol-9-carboxylic acid] which affects the methylation of EXOC3 gene CTD PMID:30521419 Exoc3 Rat ozone multiple interactions ISO EXOC3 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased oxidation of EXOC3 mRNA more ... CTD PMID:32699268 and PMID:35430440 Exoc3 Rat phenylmercury acetate increases expression ISO EXOC3 (Homo sapiens) 6480464 Phenylmercuric Acetate results in increased expression of EXOC3 mRNA CTD PMID:26272509 Exoc3 Rat piroxicam multiple interactions ISO EXOC3 (Homo sapiens) 6480464 [Piroxicam co-treated with Cisplatin] results in increased expression of EXOC3 mRNA CTD PMID:21858171 Exoc3 Rat potassium dichromate increases expression ISO EXOC3 (Homo sapiens) 6480464 Potassium Dichromate results in increased expression of EXOC3 protein CTD PMID:23718831 Exoc3 Rat pyrethrins decreases expression EXP 6480464 Pyrethrins results in decreased expression of EXOC3 protein CTD PMID:34896426 Exoc3 Rat selenium atom increases expression ISO EXOC3 (Homo sapiens) 6480464 Selenium results in increased expression of SEC6 mRNA CTD PMID:19244175 Exoc3 Rat sodium arsenite decreases expression ISO EXOC3 (Homo sapiens) 6480464 sodium arsenite results in decreased expression of EXOC3 protein CTD PMID:30528433 Exoc3 Rat sulindac decreases expression EXP 6480464 Sulindac results in decreased expression of EXOC3 mRNA CTD PMID:24136188 Exoc3 Rat tamibarotene affects expression ISO EXOC3 (Homo sapiens) 6480464 tamibarotene affects the expression of EXOC3 mRNA CTD PMID:15498508 Exoc3 Rat titanium dioxide decreases methylation ISO Exoc3 (Mus musculus) 6480464 titanium dioxide results in decreased methylation of EXOC3 gene CTD PMID:35295148 Exoc3 Rat triphenyl phosphate affects expression ISO EXOC3 (Homo sapiens) 6480464 triphenyl phosphate affects the expression of EXOC3 mRNA CTD PMID:37042841 Exoc3 Rat tungsten decreases expression ISO Exoc3 (Mus musculus) 6480464 Tungsten results in decreased expression of EXOC3 mRNA CTD PMID:30912803 Exoc3 Rat vinclozolin increases methylation EXP 6480464 vinclozolin results in increased methylation of EXOC3 gene CTD PMID:31079544 Exoc3 Rat vitamin E increases expression ISO EXOC3 (Homo sapiens) 6480464 Vitamin E results in increased expression of SEC6 mRNA CTD PMID:19244175
Imported Annotations - PID (archival)
1,2-dichloroethane (ISO) 1,2-dimethylhydrazine (ISO) 2,2',4,4'-Tetrabromodiphenyl ether (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4,6-tribromophenol (ISO) 2,4-dinitrotoluene (EXP) 3,3',4,4',5-pentachlorobiphenyl (EXP) 3,3',5,5'-tetrabromobisphenol A (ISO) 3-chloropropane-1,2-diol (EXP) 3-isobutyl-1-methyl-7H-xanthine (ISO) 3H-1,2-dithiole-3-thione (EXP) 4,4'-diaminodiphenylmethane (ISO) 4,4'-sulfonyldiphenol (ISO) acrolein (ISO) acrylamide (ISO) aflatoxin B1 (ISO) all-trans-retinoic acid (ISO) allethrin (EXP) alpha-pinene (ISO) ammonium chloride (EXP) Aroclor 1254 (EXP) arsane (ISO) arsenic atom (ISO) benzo[a]pyrene (ISO) beta-lapachone (ISO) bisphenol A (EXP,ISO) bisphenol F (ISO) butan-1-ol (ISO) cadmium atom (ISO) cadmium dichloride (ISO) caffeine (ISO) carbon nanotube (ISO) chlorpyrifos (ISO) cisplatin (ISO) copper atom (ISO) copper(0) (ISO) cyhalothrin (EXP) cypermethrin (EXP) dexamethasone (ISO) dibutyl phthalate (ISO) diuron (EXP) elemental selenium (ISO) ethanol (ISO) fenvalerate (EXP) finasteride (EXP) flutamide (EXP) formaldehyde (ISO) fulvestrant (ISO) gentamycin (EXP,ISO) indometacin (ISO) ivermectin (ISO) leflunomide (EXP) methyl methanesulfonate (ISO) Nor-9-carboxy-delta9-THC (ISO) ozone (ISO) phenylmercury acetate (ISO) piroxicam (ISO) potassium dichromate (ISO) pyrethrins (EXP) selenium atom (ISO) sodium arsenite (ISO) sulindac (EXP) tamibarotene (ISO) titanium dioxide (ISO) triphenyl phosphate (ISO) tungsten (ISO) vinclozolin (EXP) vitamin E (ISO)
1.
The glycine transporter GLYT1 interacts with Sec3, a component of the exocyst complex.
Cubelos B, etal., Neuropharmacology. 2005 Nov;49(6):935-44. doi: 10.1016/j.neuropharm.2005.07.021. Epub 2005 Sep 21.
2.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
3.
MyRIP anchors protein kinase A to the exocyst complex.
Goehring AS, etal., J Biol Chem. 2007 Nov 9;282(45):33155-67. Epub 2007 Sep 7.
4.
GRIP1 and 2 regulate activity-dependent AMPA receptor recycling via exocyst complex interactions.
Mao L, etal., Proc Natl Acad Sci U S A. 2010 Nov 2;107(44):19038-43. doi: 10.1073/pnas.1013494107. Epub 2010 Oct 18.
5.
Electronic Transfer of LocusLink and RefSeq Data
NCBI rat LocusLink and RefSeq merged data July 26, 2002
6.
PID Annotation Import Pipeline
Pipeline to import Pathway Interaction Database annotations from NCI into RGD
7.
GOA pipeline
RGD automated data pipeline
8.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
9.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
10.
rSec6 and rSec8, mammalian homologs of yeast proteins essential for secretion.
Ting AE, etal., Proc Natl Acad Sci U S A 1995 Oct 10;92(21):9613-7.
11.
Sec6 is localized to the plasma membrane of mature synaptic terminals and is transported with secretogranin II-containing vesicles.
Vik-Mo EO, etal., Neuroscience. 2003;119(1):73-85.
Exoc3 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 30,919,871 - 30,950,624 (+) NCBI GRCr8 mRatBN7.2 1 29,091,298 - 29,122,056 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 29,091,294 - 29,122,045 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 28,893,113 - 28,923,914 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 34,892,975 - 34,923,773 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 29,093,734 - 29,124,536 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 31,700,953 - 31,731,726 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 31,700,953 - 31,731,815 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 33,126,575 - 33,159,109 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 1 29,897,536 - 29,928,281 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 1 29,902,027 - 29,931,141 (+) NCBI Celera 1 27,743,063 - 27,773,955 (+) NCBI Celera Cytogenetic Map 1 p11 NCBI
EXOC3 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 5 443,176 - 467,290 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 5 443,175 - 471,937 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 5 443,291 - 467,405 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 5 496,334 - 520,411 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 5 496,374 - 520,407 NCBI Celera 5 541,456 - 565,545 (+) NCBI Celera Cytogenetic Map 5 p15.33 NCBI HuRef 5 431,407 - 455,422 (+) NCBI HuRef CHM1_1 5 443,164 - 467,222 (+) NCBI CHM1_1 T2T-CHM13v2.0 5 438,418 - 462,555 (+) NCBI T2T-CHM13v2.0
Exoc3 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 13 74,317,921 - 74,358,151 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 13 74,317,607 - 74,356,851 (-) Ensembl GRCm39 Ensembl GRCm38 13 74,169,802 - 74,210,032 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 13 74,169,488 - 74,208,732 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 13 74,307,253 - 74,346,148 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 13 74,635,807 - 74,674,702 (-) NCBI MGSCv36 mm8 Celera 13 76,499,394 - 76,538,276 (-) NCBI Celera Cytogenetic Map 13 C1 NCBI cM Map 13 40.15 NCBI
Exoc3 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955504 196,695 - 223,812 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955504 195,743 - 223,812 (+) NCBI ChiLan1.0 ChiLan1.0
EXOC3 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 4 662,394 - 690,011 (+) NCBI NHGRI_mPanPan1-v2 PanPan1.1 Ensembl 5 568,471 - 596,723 (+) Ensembl panpan1.1 panPan2
EXOC3 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 34 11,790,927 - 11,811,566 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 34 11,791,926 - 11,811,561 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 34 16,304,626 - 16,325,902 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 34 11,695,749 - 11,716,848 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 34 11,694,759 - 11,716,578 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 34 11,746,203 - 11,767,708 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 34 11,727,053 - 11,748,335 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 34 11,937,421 - 11,958,497 (-) NCBI UU_Cfam_GSD_1.0
Exoc3 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024407213 244,844,352 - 244,861,748 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936815 1,005,560 - 1,023,070 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936815 1,005,637 - 1,022,916 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
EXOC3
EXOC3
Exoc3
.
Predicted Target Of
Count of predictions: 116 Count of miRNA genes: 86 Interacting mature miRNAs: 92 Transcripts: ENSRNOT00000020251 Prediction methods: Microtar, Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
631688 Hcas2 Hepatocarcinoma susceptibility QTL 2 3 0.0001 liver integrity trait (VT:0010547) liver tumorous lesion number (CMO:0001068) 1 5925874 115540829 Rat 1357397 Bw41 Body weight QTL 41 4.19 0.0001 body mass (VT:0001259) body weight (CMO:0000012) 1 22340647 49361612 Rat 1578650 Bmd6 Bone mineral density QTL 6 12.2 femur mineral mass (VT:0010011) total volumetric bone mineral density (CMO:0001728) 1 509108 43284926 Rat 1578651 Bmd7 Bone mineral density QTL 7 14.2 femur mineral mass (VT:0010011) compact volumetric bone mineral density (CMO:0001730) 1 509108 43284926 Rat 2313062 Bmd73 Bone mineral density QTL 73 3.9 0.0001 tibia mineral mass (VT:1000283) compact volumetric bone mineral density (CMO:0001730) 1 11481312 82174945 Rat 1554320 Bmd1 Bone mineral density QTL 1 12.2 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 1 509108 86060548 Rat 2313065 Bss67 Bone structure and strength QTL 67 3.1 0.0001 tibia area (VT:1000281) tibia total energy absorbed before break (CMO:0001736) 1 11481312 82174945 Rat 7421626 Bp360 Blood pressure QTL 360 0.001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 4393289 49393289 Rat 1357400 Bw62 Body weight QTL62 4.05 inguinal fat pad mass (VT:0010424) inguinal fat pad weight to body weight ratio (CMO:0001253) 1 22340647 67340647 Rat 2313070 Bss52 Bone structure and strength QTL 52 4.4 0.0001 body length (VT:0001256) body length (CMO:0000013) 1 1 32356093 Rat 1357401 Bw43 Body weight QTL 43 3.75 body mass (VT:0001259) body weight (CMO:0000012) 1 22340647 49361612 Rat 2313069 Bss68 Bone structure and strength QTL 68 2.9 0.0001 tibia size trait (VT:0100001) tibia total energy absorbed before break (CMO:0001736) 1 11481312 82174945 Rat 631495 Bp96 Blood pressure QTL 96 4.52 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 22340647 102268831 Rat 631494 Bp95 Blood pressure QTL 95 40 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 16206210 49268520 Rat 2313075 Bss66 Bone structure and strength QTL 66 3.4 0.0001 tibia length (VT:0004357) tibia length (CMO:0000450) 1 11481312 82174945 Rat 5684998 Bss101 Bone structure and strength QTL 101 3.6 tibia strength trait (VT:1000284) tibia ultimate force (CMO:0001734) 1 15431621 49361612 Rat 5684999 Bss102 Bone structure and strength QTL 102 5.5 7e-07 tibia strength trait (VT:1000284) tibia stiffness (CMO:0001735) 1 15431621 49361612 Rat 1300167 Hrtrt2 Heart rate QTL 2 4.35 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 1 11481312 75088344 Rat 2313077 Bss69 Bone structure and strength QTL 69 3.5 0.0001 tibia strength trait (VT:1000284) bone polar moment of inertia (CMO:0001558) 1 11481312 82174945 Rat 2317755 Glom22 Glomerulus QTL 22 3.8 urine protein amount (VT:0005160) urine protein level (CMO:0000591) 1 11481482 32355910 Rat 1578756 Iddm22 Insulin dependent diabetes mellitus QTL 22 2.7 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 1 11835181 56835181 Rat 631508 Sald1 Serum aldosterone level QTL 1 3.7 blood aldosterone amount (VT:0005346) serum aldosterone level (CMO:0000487) 1 9856001 54856001 Rat 1331785 Rf27 Renal function QTL 27 4.643 urine sodium amount (VT:0006274) urine sodium level (CMO:0000129) 1 28879780 78430678 Rat 2313090 Bmd69 Bone mineral density QTL 69 4.4 0.0001 tibia mineral mass (VT:1000283) compact volumetric bone mineral density (CMO:0001730) 1 1 32356093 Rat 724520 Bp145 Blood pressure QTL 145 2.1 0.0024 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 20784828 65784828 Rat 1558642 Prcr2 Prostate cancer resistance QTL 2 4.3 prostate integrity trait (VT:0010571) area of ventral prostate occupied by tumorous lesions to total ventral prostate area ratio (CMO:0000899) 1 20763158 44095856 Rat 2313092 Bmd72 Bone mineral density QTL 72 2.5 0.0001 tibia mineral mass (VT:1000283) total volumetric bone mineral density (CMO:0001728) 1 11481312 82174945 Rat 2313097 Bss70 Bone structure and strength QTL 70 3.5 0.0001 tibia strength trait (VT:1000284) tibia total energy absorbed before break (CMO:0001736) 1 11481312 82174945 Rat 738020 Pia8 Pristane induced arthritis QTL 8 4.7 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 1 1 65833076 Rat 1600360 Mcs16 Mammary carcinoma susceptibility QTL 16 2.4 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 1 2244390 43433040 Rat 1578669 Bss9 Bone structure and strength QTL 9 6.3 femur morphology trait (VT:0000559) bone trabecular cross-sectional area (CMO:0002311) 1 509108 43284926 Rat 2302038 Pia31 Pristane induced arthritis QTL 31 5.5 0.001 blood autoantibody amount (VT:0003725) serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111) 1 10992065 55992065 Rat 634353 Rends2 Renal damage susceptibility QTL 2 0.05 kidney blood vessel morphology trait (VT:0000530) organ lesion measurement (CMO:0000677) 1 19333571 56983283 Rat 2313053 Bss51 Bone structure and strength QTL 51 3.8 0.0001 tibia length (VT:0004357) tibia length (CMO:0000450) 1 1 32356093 Rat
D1Got38
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 1 29,098,144 - 29,098,329 (+) MAPPER mRatBN7.2 Rnor_6.0 1 31,707,798 - 31,707,982 NCBI Rnor6.0 Rnor_5.0 1 33,133,228 - 33,133,412 UniSTS Rnor5.0 RGSC_v3.4 1 29,904,378 - 29,904,563 RGD RGSC3.4 RGSC_v3.4 1 29,904,379 - 29,904,563 UniSTS RGSC3.4 RGSC_v3.1 1 29,907,323 - 29,907,508 RGD Celera 1 27,749,908 - 27,750,092 UniSTS Cytogenetic Map 1 p11 UniSTS
RH131026
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 1 29,121,898 - 29,122,081 (+) MAPPER mRatBN7.2 Rnor_6.0 1 31,731,552 - 31,731,734 NCBI Rnor6.0 Rnor_5.0 1 33,156,832 - 33,157,014 UniSTS Rnor5.0 RGSC_v3.4 1 29,928,133 - 29,928,315 UniSTS RGSC3.4 Celera 1 27,773,807 - 27,773,989 UniSTS Cytogenetic Map 1 p11 UniSTS
RH142744
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 1 29,103,267 - 29,103,539 (+) MAPPER mRatBN7.2 Rnor_6.0 1 31,712,921 - 31,713,192 NCBI Rnor6.0 Rnor_5.0 1 33,138,201 - 33,138,472 UniSTS Rnor5.0 RGSC_v3.4 1 29,909,502 - 29,909,773 UniSTS RGSC3.4 Celera 1 27,755,181 - 27,755,452 UniSTS RH 3.4 Map 1 342.9 UniSTS Cytogenetic Map 1 p11 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000020251 ⟹ ENSRNOP00000020251
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 1 29,091,298 - 29,122,045 (+) Ensembl Rnor_6.0 Ensembl 1 31,700,953 - 31,731,700 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000077740 ⟹ ENSRNOP00000072705
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 1 29,091,294 - 29,122,045 (+) Ensembl Rnor_6.0 Ensembl 1 31,702,485 - 31,731,815 (+) Ensembl
RefSeq Acc Id:
NM_001024964 ⟹ NP_001020135
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 30,919,875 - 30,950,622 (+) NCBI mRatBN7.2 1 29,091,298 - 29,122,047 (+) NCBI Rnor_6.0 1 31,700,953 - 31,731,700 (+) NCBI Rnor_5.0 1 33,126,575 - 33,159,109 (+) NCBI RGSC_v3.4 1 29,897,536 - 29,928,281 (+) RGD Celera 1 27,743,063 - 27,773,955 (+) RGD
Sequence:
CCGGGAGGTGGAAGCAGCTGCGCGGATGTGTACCTGTGGTATGACATGTGCAAAGATTCTGCCTGCTTTTCGACTATGAAGGAGACAGACCTGGAGGCTGTTGCAACAGCAGTCCAAAGGGTGGCTGG
hide sequence
RefSeq Acc Id:
XM_006227767 ⟹ XP_006227829
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 30,919,871 - 30,950,624 (+) NCBI mRatBN7.2 1 29,091,332 - 29,122,056 (+) NCBI Rnor_6.0 1 31,700,987 - 31,731,726 (+) NCBI Rnor_5.0 1 33,126,575 - 33,159,109 (+) NCBI
Sequence:
AAGCTCTGCTTTGACAGCTTTGGGTCACCGTGCGGTGGGCGGGGCGCTGGGCCCTCAACTCTGGCACAGTGTACCCCTCAGTGGGTTTGTCCTTGGCGAGGGACAGCATCGGCCGACGTTTCTGGCGG
hide sequence
RefSeq Acc Id:
XM_006227768 ⟹ XP_006227830
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 30,919,890 - 30,950,624 (+) NCBI mRatBN7.2 1 29,091,543 - 29,122,056 (+) NCBI Rnor_6.0 1 31,701,153 - 31,731,726 (+) NCBI Rnor_5.0 1 33,126,575 - 33,159,109 (+) NCBI
Sequence:
GGGTTTGTCCTCCGTGTGCGTCCCCACCCCCTATCCCCGCCTTGGTCCCTTCTGCTTCTACCCTCAGAGTTCCCTTTTGCCCCTGAGACCGGAAATCTGACAGTCCTTTAGCTGCCTTTGGATACAGA
hide sequence
RefSeq Acc Id:
NP_001020135 ⟸ NM_001024964
- UniProtKB:
Q4QQU2 (UniProtKB/Swiss-Prot), Q62825 (UniProtKB/Swiss-Prot), A6JUV0 (UniProtKB/TrEMBL), A0A8L2QA79 (UniProtKB/TrEMBL)
- Sequence:
MCKDSACFSTMKETDLEAVATAVQRVAGMLQRPDQLDKVEQYRRREARKKASVEARLKAAIQSQLDGVRTGLSQLHNALNDVKDIQQSLADVSKDWRQSINTIESLKDVKDAVVQHSQLAAAVENLKN
hide sequence
RefSeq Acc Id:
XP_006227829 ⟸ XM_006227767
- Peptide Label:
isoform X1
- UniProtKB:
Q4QQU2 (UniProtKB/Swiss-Prot), Q62825 (UniProtKB/Swiss-Prot), A6JUV0 (UniProtKB/TrEMBL), A0A8L2QA79 (UniProtKB/TrEMBL)
- Sequence:
MCKDSACFSTMKETDLEAVATAVQRVAGMLQRPDQLDKVEQYRRREARKKASVEARLKAAIQSQLDGVRTGLSQLHNALNDVKDIQQSLADVSKDWRQSINTIESLKDVKDAVVQHSQLAAAVENLKN
hide sequence
RefSeq Acc Id:
XP_006227830 ⟸ XM_006227768
- Peptide Label:
isoform X1
- UniProtKB:
Q4QQU2 (UniProtKB/Swiss-Prot), Q62825 (UniProtKB/Swiss-Prot), A6JUV0 (UniProtKB/TrEMBL), A0A8L2QA79 (UniProtKB/TrEMBL)
- Sequence:
MCKDSACFSTMKETDLEAVATAVQRVAGMLQRPDQLDKVEQYRRREARKKASVEARLKAAIQSQLDGVRTGLSQLHNALNDVKDIQQSLADVSKDWRQSINTIESLKDVKDAVVQHSQLAAAVENLKN
hide sequence
Ensembl Acc Id:
ENSRNOP00000072705 ⟸ ENSRNOT00000077740
Ensembl Acc Id:
ENSRNOP00000020251 ⟸ ENSRNOT00000020251
RGD ID: 13689557 Promoter ID: EPDNEW_R82 Type: multiple initiation site Name: Exoc3_1 Description: exocyst complex component 3 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 1 31,700,938 - 31,700,998 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2006-03-30
Exoc3
exocyst complex component 3
Sec6l1
SEC6-like 1 (S. cerevisiae)
Symbol and Name updated
1299863 APPROVED
2004-09-10
Sec6l1
SEC6-like 1 (S. cerevisiae)
Sec6
RSec6 protein
Symbol and Name updated
1299863 APPROVED
2002-08-07
Sec6
RSec6 protein
Symbol and Name status set to provisional
70820 PROVISIONAL
Note Type
Note
Reference
gene_homology
shows 22% amino acid identity to yeast Sec6p
633933
gene_protein
87-kDa protein
633933
