Symbol:
Ch25h
Name:
cholesterol 25-hydroxylase
RGD ID:
1310575
Description:
Predicted to enable C-4 methylsterol oxidase activity and cholesterol 25-hydroxylase activity. Predicted to be involved in several processes, including B cell chemotaxis; negative regulation of fusion of virus membrane with host plasma membrane; and sterol metabolic process. Predicted to be active in endoplasmic reticulum membrane. Orthologous to human CH25H (cholesterol 25-hydroxylase); PARTICIPATES IN bile acid biosynthetic pathway; cerebrotendinous xanthomatosis pathway; congenital bile acid synthesis defect pathway; INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; acetamide; acrolein.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
cholesterol 25-monooxygenase; LOC309527
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
CH25H (cholesterol 25-hydroxylase) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):
Ch25h (cholesterol 25-hydroxylase) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Ch25h (cholesterol 25-hydroxylase) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
CH25H (cholesterol 25-hydroxylase) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
CH25H (cholesterol 25-hydroxylase) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Ch25h (cholesterol 25-hydroxylase) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
CH25H (cholesterol 25-hydroxylase) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
CH25H (cholesterol 25-hydroxylase) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Ch25h (cholesterol 25-hydroxylase) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Other homologs 2
Homo sapiens (human):
CCDC42 (coiled-coil domain containing 42) HGNC
OMA
Alliance orthologs 3
Homo sapiens (human):
CH25H (cholesterol 25-hydroxylase)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Ch25h (cholesterol 25-hydroxylase)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
ch25h (cholesterol 25-hydroxylase)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Caenorhabditis elegans (roundworm):
F35C8.5
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Saccharomyces cerevisiae (baker's yeast):
SUR2
Alliance
DIOPT (Ensembl Compara|OrthoFinder)
Xenopus tropicalis (tropical clawed frog):
ch25h
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 241,428,048 - 241,429,366 (-) NCBI GRCr8 mRatBN7.2 1 232,014,877 - 232,016,195 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 232,014,880 - 232,016,195 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 240,404,834 - 240,406,152 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 247,327,664 - 247,328,982 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 240,165,868 - 240,167,186 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 252,807,062 - 252,811,409 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 252,807,065 - 252,808,380 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 260,028,706 - 260,035,142 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 1 238,457,017 - 238,458,335 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 1 238,620,925 - 238,622,241 (-) NCBI Celera 1 229,127,450 - 229,128,768 (-) NCBI Celera Cytogenetic Map 1 q53 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Ch25h Rat 2,2',4,4'-Tetrabromodiphenyl ether affects expression ISO RGD:1321560 6480464 2,2',4,4'-tetrabromodiphenyl ether affects the expression of CH25H mRNA CTD PMID:31173147 Ch25h Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO RGD:1321561 6480464 Tetrachlorodibenzodioxin results in decreased expression of CH25H mRNA CTD PMID:17035482|PMID:19933214 Ch25h Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of CH25H mRNA CTD PMID:33387578|PMID:34747641 Ch25h Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of CH25H mRNA CTD PMID:22298810 Ch25h Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO RGD:1321561 6480464 Tetrachlorodibenzodioxin promotes the reaction [AHR protein binds to CH25H promoter] CTD PMID:19654925 Ch25h Rat 2,4-dibromophenyl 2,4,5-tribromophenyl ether increases expression ISO RGD:1321560 6480464 2,2',4,4',5-brominated diphenyl ether results in increased expression of CH25H mRNA CTD PMID:26705709 Ch25h Rat 3,3',5,5'-tetrabromobisphenol A increases expression ISO RGD:1321560 6480464 tetrabromobisphenol A results in increased expression of CH25H mRNA CTD PMID:33476716 Ch25h Rat 3,4-methylenedioxymethamphetamine decreases expression ISO RGD:1321561 6480464 N-Methyl-3,4-methylenedioxyamphetamine results in decreased expression of CH25H mRNA CTD PMID:20188158 Ch25h Rat 3-isobutyl-1-methyl-7H-xanthine multiple interactions ISO RGD:1321560 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] more ... CTD PMID:28628672 Ch25h Rat 4,4'-sulfonyldiphenol multiple interactions ISO RGD:1321560 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] more ... CTD PMID:28628672 Ch25h Rat acetamide increases expression EXP 6480464 acetamide results in increased expression of CH25H mRNA CTD PMID:31881176 Ch25h Rat acrolein increases expression EXP 6480464 Acrolein results in increased expression of CH25H mRNA CTD PMID:38090360 Ch25h Rat acrylamide decreases expression ISO RGD:1321561 6480464 Acrylamide results in decreased expression of CH25H mRNA CTD PMID:35032568 Ch25h Rat aflatoxin B1 increases expression EXP 6480464 Aflatoxin B1 results in increased expression of CH25H mRNA CTD PMID:25378103 Ch25h Rat all-trans-retinoic acid multiple interactions ISO RGD:1321561 6480464 [mono-(2-ethylhexyl)phthalate co-treated with Tretinoin] results in decreased expression of CH25H mRNA CTD PMID:36189433 Ch25h Rat arsenite(3-) multiple interactions ISO RGD:1321560 6480464 arsenite inhibits the reaction [G3BP1 protein binds to CH25H mRNA] CTD PMID:32406909 Ch25h Rat benzo[a]pyrene increases expression ISO RGD:1321561 6480464 Benzo(a)pyrene results in increased expression of CH25H mRNA CTD PMID:22228805 Ch25h Rat benzo[a]pyrene decreases methylation ISO RGD:1321560 6480464 Benzo(a)pyrene results in decreased methylation of CH25H exon CTD PMID:27901495 Ch25h Rat benzo[a]pyrene affects methylation ISO RGD:1321560 6480464 Benzo(a)pyrene affects the methylation of CH25H promoter CTD PMID:27901495 Ch25h Rat beta-naphthoflavone multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with beta-Naphthoflavone] results in increased expression of CH25H mRNA CTD PMID:18164116 Ch25h Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of CH25H mRNA CTD PMID:25181051 Ch25h Rat bisphenol A decreases methylation ISO RGD:1321560 6480464 bisphenol A results in decreased methylation of CH25H gene CTD PMID:31601247 Ch25h Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of CH25H mRNA CTD PMID:34947998 Ch25h Rat bisphenol A increases expression ISO RGD:1321560 6480464 bisphenol A results in increased expression of CH25H mRNA CTD PMID:31715268 Ch25h Rat bisphenol A increases methylation EXP 6480464 bisphenol A results in increased methylation of CH25H gene CTD PMID:28505145 Ch25h Rat bisphenol A multiple interactions ISO RGD:1321560 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] more ... CTD PMID:28628672 Ch25h Rat bisphenol A decreases expression ISO RGD:1321560 6480464 bisphenol A results in decreased expression of CH25H mRNA CTD PMID:27685785 Ch25h Rat cadmium dichloride decreases expression EXP 6480464 Cadmium Chloride results in decreased expression of CH25H mRNA CTD PMID:33453195 Ch25h Rat carbofuran increases expression EXP 6480464 Carbofuran results in increased expression of CH25H mRNA CTD PMID:20211217 Ch25h Rat carbon nanotube increases expression ISO RGD:1321561 6480464 Nanotubes, Carbon analog results in increased expression of CH25H mRNA; Nanotubes, Carbon results in increased more ... CTD PMID:25554681 Ch25h Rat carbon nanotube increases expression EXP 6480464 Nanotubes, Carbon results in increased expression of CH25H mRNA CTD PMID:19836432 Ch25h Rat CGP 52608 multiple interactions ISO RGD:1321560 6480464 CGP 52608 promotes the reaction [RORA protein binds to CH25H gene] CTD PMID:28238834 Ch25h Rat chloroprene decreases expression ISO RGD:1321561 6480464 Chloroprene results in decreased expression of CH25H mRNA CTD PMID:23125180 Ch25h Rat chromium(6+) affects expression ISO RGD:1321561 6480464 chromium hexavalent ion affects the expression of CH25H mRNA CTD PMID:28472532 Ch25h Rat cisplatin decreases expression EXP 6480464 Cisplatin results in decreased expression of CH25H mRNA CTD PMID:22023808 Ch25h Rat clarithromycin increases expression ISO RGD:1321561 6480464 Clarithromycin results in increased expression of CH25H mRNA CTD PMID:34458952 Ch25h Rat decabromodiphenyl ether increases expression EXP 6480464 decabromobiphenyl ether results in increased expression of CH25H mRNA CTD PMID:23640034 Ch25h Rat dexamethasone decreases expression ISO RGD:1321561 6480464 Dexamethasone results in decreased expression of CH25H mRNA CTD PMID:22733784 Ch25h Rat dexamethasone multiple interactions ISO RGD:1321560 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] more ... CTD PMID:28628672 Ch25h Rat dexamethasone decreases expression ISO RGD:1321560 6480464 Dexamethasone results in decreased expression of CH25H mRNA CTD PMID:25047013 Ch25h Rat dibutyl phthalate increases expression EXP 6480464 Dibutyl Phthalate results in increased expression of CH25H mRNA CTD PMID:21266533 Ch25h Rat dioxygen increases expression ISO RGD:1321561 6480464 Oxygen deficiency results in increased expression of CH25H mRNA CTD PMID:20880076 Ch25h Rat dioxygen multiple interactions ISO RGD:1321561 6480464 [NFE2L2 protein affects the susceptibility to Oxygen] which affects the expression of CH25H mRNA CTD PMID:30529165 Ch25h Rat doxorubicin increases expression EXP 6480464 Doxorubicin results in increased expression of CH25H mRNA CTD PMID:20211217 Ch25h Rat doxorubicin increases expression ISO RGD:1321561 6480464 Doxorubicin results in increased expression of CH25H mRNA CTD PMID:36227756 Ch25h Rat endosulfan increases expression EXP 6480464 Endosulfan results in increased expression of CH25H mRNA CTD PMID:29391264 Ch25h Rat fulvestrant increases methylation ISO RGD:1321560 6480464 Fulvestrant results in increased methylation of CH25H gene CTD PMID:31601247 Ch25h Rat furan increases methylation EXP 6480464 furan results in increased methylation of CH25H gene CTD PMID:22079235 Ch25h Rat furan increases expression EXP 6480464 furan results in increased expression of CH25H mRNA CTD PMID:27387713 Ch25h Rat genistein increases expression ISO RGD:1321561 6480464 Genistein results in increased expression of CH25H mRNA CTD PMID:32186404 Ch25h Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of CH25H mRNA CTD PMID:33387578 Ch25h Rat glycidol decreases expression EXP 6480464 glycidol results in decreased expression of CH25H mRNA CTD PMID:24915197 Ch25h Rat graphene oxide increases expression ISO RGD:1321561 6480464 graphene oxide analog results in increased expression of CH25H mRNA; graphene oxide results in increased more ... CTD PMID:33227293 Ch25h Rat hydroquinone increases expression ISO RGD:1321560 6480464 hydroquinone results in increased expression of CH25H mRNA CTD PMID:31256213 Ch25h Rat indometacin multiple interactions ISO RGD:1321560 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] more ... CTD PMID:28628672 Ch25h Rat isoprenaline increases expression EXP 6480464 Isoproterenol results in increased expression of CH25H mRNA CTD PMID:20211217 Ch25h Rat lipopolysaccharide multiple interactions ISO RGD:1321560 6480464 S-(1,2-dichlorovinyl)cysteine inhibits the reaction [Lipopolysaccharides results in increased expression of CH25H mRNA] CTD PMID:35811015 Ch25h Rat lipopolysaccharide increases expression ISO RGD:1321560 6480464 Lipopolysaccharides results in increased expression of CH25H mRNA CTD PMID:35811015 Ch25h Rat loperamide increases expression ISO RGD:1321561 6480464 Loperamide results in increased expression of CH25H mRNA CTD PMID:35926757 Ch25h Rat malathion increases expression ISO RGD:1321560 6480464 Malathion results in increased expression of CH25H mRNA CTD PMID:37047231 Ch25h Rat manganese(II) chloride increases expression EXP 6480464 manganese chloride results in increased expression of CH25H mRNA CTD PMID:28801915 Ch25h Rat mono(2-ethylhexyl) phthalate multiple interactions ISO RGD:1321561 6480464 [mono-(2-ethylhexyl)phthalate co-treated with Tretinoin] results in decreased expression of CH25H mRNA CTD PMID:36189433 Ch25h Rat Muraglitazar decreases expression EXP 6480464 muraglitazar results in decreased expression of CH25H mRNA CTD PMID:21515302 Ch25h Rat N-nitrosodiethylamine multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with beta-Naphthoflavone] results in increased expression of CH25H mRNA CTD PMID:18164116 Ch25h Rat naphthalene increases expression ISO RGD:1321561 6480464 naphthalene results in increased expression of CH25H mRNA CTD PMID:18978301 Ch25h Rat nickel atom increases expression ISO RGD:1321560 6480464 Nickel results in increased expression of CH25H mRNA CTD PMID:25583101 Ch25h Rat nitrofen increases expression EXP 6480464 nitrofen results in increased expression of CH25H mRNA CTD PMID:26720608 Ch25h Rat ozone multiple interactions ISO RGD:1321561 6480464 [Air Pollutants results in increased abundance of [Ozone co-treated with Soot]] which results in increased more ... CTD PMID:19555225|PMID:24381131|PMID:25658374|PMID:27106289|PMID:34911549 Ch25h Rat ozone increases expression ISO RGD:1321561 6480464 Ozone results in increased expression of CH25H mRNA CTD PMID:17095637|PMID:25658374 Ch25h Rat paracetamol affects expression ISO RGD:1321561 6480464 Acetaminophen affects the expression of CH25H mRNA CTD PMID:17562736 Ch25h Rat phosgene affects expression ISO RGD:1321561 6480464 Phosgene affects the expression of CH25H mRNA CTD PMID:16300373 Ch25h Rat potassium dichromate increases expression ISO RGD:1321561 6480464 Potassium Dichromate results in increased expression of CH25H mRNA CTD PMID:23608068 Ch25h Rat pregnenolone 16alpha-carbonitrile decreases expression ISO RGD:1321561 6480464 Pregnenolone Carbonitrile results in decreased expression of CH25H mRNA CTD PMID:22698814 Ch25h Rat progesterone decreases expression ISO RGD:1321560 6480464 Progesterone results in decreased expression of CH25H mRNA CTD PMID:21795739 Ch25h Rat progesterone decreases expression ISO RGD:1321561 6480464 Progesterone results in decreased expression of CH25H mRNA CTD PMID:22238285 Ch25h Rat quartz increases expression EXP 6480464 Quartz results in increased expression of CH25H mRNA CTD PMID:19836432 Ch25h Rat S-(1,2-dichlorovinyl)-L-cysteine multiple interactions ISO RGD:1321560 6480464 S-(1,2-dichlorovinyl)cysteine inhibits the reaction [Lipopolysaccharides results in increased expression of CH25H mRNA] CTD PMID:35811015 Ch25h Rat S-(1,2-dichlorovinyl)-L-cysteine decreases expression ISO RGD:1321560 6480464 S-(1,2-dichlorovinyl)cysteine results in decreased expression of CH25H mRNA CTD PMID:35811015 Ch25h Rat S-nitrosoglutathione decreases expression ISO RGD:1321560 6480464 S-Nitrosoglutathione results in decreased expression of CH25H mRNA CTD PMID:38825487 Ch25h Rat serpentine asbestos increases expression ISO RGD:1321561 6480464 Asbestos, Serpentine results in increased expression of CH25H mRNA CTD PMID:16251409 Ch25h Rat silicon dioxide increases expression ISO RGD:1321561 6480464 Silicon Dioxide results in increased expression of CH25H mRNA CTD PMID:23221170|PMID:29341224|PMID:38811393 Ch25h Rat silicon dioxide increases expression ISO RGD:1321560 6480464 Silicon Dioxide results in increased expression of CH25H mRNA CTD PMID:25351596 Ch25h Rat silicon dioxide increases expression EXP 6480464 Silicon Dioxide results in increased expression of CH25H mRNA CTD PMID:22431001 Ch25h Rat sodium arsenite multiple interactions ISO RGD:1321560 6480464 [sodium arsenite affects the acetylation of H3-4 protein] which affects the methylation of CH25H promoter CTD PMID:18448484 Ch25h Rat sodium arsenite decreases expression ISO RGD:1321561 6480464 sodium arsenite results in decreased expression of CH25H mRNA CTD PMID:37682722 Ch25h Rat Soman increases expression EXP 6480464 Soman results in increased expression of CH25H mRNA CTD PMID:19281266 Ch25h Rat Tesaglitazar decreases expression EXP 6480464 tesaglitazar results in decreased expression of CH25H mRNA CTD PMID:21515302 Ch25h Rat tetrachloromethane increases expression ISO RGD:1321561 6480464 Carbon Tetrachloride results in increased expression of CH25H mRNA CTD PMID:17484886|PMID:31919559 Ch25h Rat tetrachloromethane increases expression EXP 6480464 Carbon Tetrachloride results in increased expression of CH25H mRNA CTD PMID:31150632 Ch25h Rat thioacetamide increases expression EXP 6480464 Thioacetamide results in increased expression of CH25H mRNA CTD PMID:26222700|PMID:34492290 Ch25h Rat titanium dioxide increases expression ISO RGD:1321561 6480464 titanium dioxide results in increased expression of CH25H mRNA CTD PMID:21259345|PMID:23557971|PMID:27760801 Ch25h Rat titanium dioxide increases expression EXP 6480464 titanium dioxide results in increased expression of CH25H mRNA CTD PMID:30012374 Ch25h Rat titanium dioxide affects expression ISO RGD:1321561 6480464 titanium dioxide affects the expression of CH25H mRNA CTD PMID:17656681 Ch25h Rat trichloroethene increases expression EXP 6480464 Trichloroethylene results in increased expression of CH25H mRNA CTD PMID:33387578 Ch25h Rat troglitazone decreases expression EXP 6480464 troglitazone results in decreased expression of CH25H mRNA CTD PMID:21515302 Ch25h Rat valproic acid affects expression ISO RGD:1321561 6480464 Valproic Acid affects the expression of CH25H mRNA CTD PMID:17292431 Ch25h Rat valproic acid increases expression ISO RGD:1321560 6480464 Valproic Acid results in increased expression of CH25H mRNA CTD PMID:28001369 Ch25h Rat valproic acid increases expression EXP 6480464 Valproic Acid results in increased expression of CH25H mRNA CTD PMID:29427782
Imported Annotations - SMPDB
Imported Annotations - KEGG (archival)
2,2',4,4'-Tetrabromodiphenyl ether (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4-dibromophenyl 2,4,5-tribromophenyl ether (ISO) 3,3',5,5'-tetrabromobisphenol A (ISO) 3,4-methylenedioxymethamphetamine (ISO) 3-isobutyl-1-methyl-7H-xanthine (ISO) 4,4'-sulfonyldiphenol (ISO) acetamide (EXP) acrolein (EXP) acrylamide (ISO) aflatoxin B1 (EXP) all-trans-retinoic acid (ISO) arsenite(3-) (ISO) benzo[a]pyrene (ISO) beta-naphthoflavone (EXP) bisphenol A (EXP,ISO) cadmium dichloride (EXP) carbofuran (EXP) carbon nanotube (EXP,ISO) CGP 52608 (ISO) chloroprene (ISO) chromium(6+) (ISO) cisplatin (EXP) clarithromycin (ISO) decabromodiphenyl ether (EXP) dexamethasone (ISO) dibutyl phthalate (EXP) dioxygen (ISO) doxorubicin (EXP,ISO) endosulfan (EXP) fulvestrant (ISO) furan (EXP) genistein (ISO) gentamycin (EXP) glycidol (EXP) graphene oxide (ISO) hydroquinone (ISO) indometacin (ISO) isoprenaline (EXP) lipopolysaccharide (ISO) loperamide (ISO) malathion (ISO) manganese(II) chloride (EXP) mono(2-ethylhexyl) phthalate (ISO) Muraglitazar (EXP) N-nitrosodiethylamine (EXP) naphthalene (ISO) nickel atom (ISO) nitrofen (EXP) ozone (ISO) paracetamol (ISO) phosgene (ISO) potassium dichromate (ISO) pregnenolone 16alpha-carbonitrile (ISO) progesterone (ISO) quartz (EXP) S-(1,2-dichlorovinyl)-L-cysteine (ISO) S-nitrosoglutathione (ISO) serpentine asbestos (ISO) silicon dioxide (EXP,ISO) sodium arsenite (ISO) Soman (EXP) Tesaglitazar (EXP) tetrachloromethane (EXP,ISO) thioacetamide (EXP) titanium dioxide (EXP,ISO) trichloroethene (EXP) troglitazone (EXP) valproic acid (EXP,ISO)
Ch25h Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 241,428,048 - 241,429,366 (-) NCBI GRCr8 mRatBN7.2 1 232,014,877 - 232,016,195 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 232,014,880 - 232,016,195 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 240,404,834 - 240,406,152 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 247,327,664 - 247,328,982 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 240,165,868 - 240,167,186 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 252,807,062 - 252,811,409 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 252,807,065 - 252,808,380 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 260,028,706 - 260,035,142 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 1 238,457,017 - 238,458,335 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 1 238,620,925 - 238,622,241 (-) NCBI Celera 1 229,127,450 - 229,128,768 (-) NCBI Celera Cytogenetic Map 1 q53 NCBI
CH25H Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 10 89,205,629 - 89,207,317 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 10 89,205,629 - 89,207,317 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 10 90,965,386 - 90,967,074 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 10 90,955,674 - 90,957,051 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 10 90,955,673 - 90,957,051 NCBI Celera 10 84,712,523 - 84,713,900 (-) NCBI Celera Cytogenetic Map 10 q23.31 NCBI HuRef 10 84,600,155 - 84,601,532 (-) NCBI HuRef CHM1_1 10 91,247,750 - 91,249,127 (-) NCBI CHM1_1 T2T-CHM13v2.0 10 90,089,526 - 90,091,214 (-) NCBI T2T-CHM13v2.0
Ch25h Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 19 34,451,183 - 34,452,548 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 19 34,451,178 - 34,452,564 (-) Ensembl GRCm39 Ensembl GRCm38 19 34,473,783 - 34,475,148 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 19 34,473,778 - 34,475,164 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 19 34,548,273 - 34,549,625 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 19 34,539,780 - 34,541,132 (-) NCBI MGSCv36 mm8 Celera 19 35,249,457 - 35,250,809 (-) NCBI Celera Cytogenetic Map 19 C1 NCBI cM Map 19 29.69 NCBI
Ch25h Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 NW_004955425 3,763,302 - 3,764,432 (+) NCBI ChiLan1.0 ChiLan1.0
CH25H Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 8 101,224,225 - 101,225,577 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 10 101,229,539 - 101,230,993 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 10 85,930,638 - 85,932,065 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 10 89,470,908 - 89,472,278 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 10 89,471,441 - 89,472,259 (-) Ensembl panpan1.1 panPan2
CH25H Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 26 38,884,356 - 38,885,728 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 26 38,635,628 - 38,637,001 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 26 40,468,717 - 40,470,089 (-) NCBI ROS_Cfam_1.0 UMICH_Zoey_3.1 26 38,339,014 - 38,340,386 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 26 37,902,557 - 37,903,928 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 26 39,172,313 - 39,173,684 (-) NCBI UU_Cfam_GSD_1.0
Ch25h Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024407213 43,382,065 - 43,384,853 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936601 5,015,219 - 5,160,908 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936601 5,015,922 - 5,016,942 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
CH25H Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 14 101,123,398 - 101,125,593 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 14 101,122,318 - 101,128,622 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 14 110,108,096 - 110,110,898 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
CH25H Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 9 82,632,151 - 82,634,101 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 9 82,633,004 - 82,633,819 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666048 43,308,387 - 43,309,759 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Ch25h
.
Predicted Target Of
Count of predictions: 19 Count of miRNA genes: 17 Interacting mature miRNAs: 19 Transcripts: ENSRNOT00000025856 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
8693637 Alc29 Alcohol consumption QTL 29 2.7 0.258 drinking behavior trait (VT:0001422) calculated ethanol drink intake rate (CMO:0001615) 1 207987464 234238494 Rat 1578778 Pur4 Proteinuria QTL 4 3.3 0.003 urine total protein amount (VT:0000032) urine total protein excretion rate (CMO:0000756) 1 150700247 252085048 Rat 1354646 Kidm18 Kidney mass QTL 18 5.7 kidney mass (VT:0002707) calculated kidney weight (CMO:0000160) 1 151162512 256448636 Rat 1357335 Bw39 Body weight QTL 39 3.3 body mass (VT:0001259) body weight (CMO:0000012) 1 197814409 242814409 Rat 2302375 Bw83 Body weight QTL 83 4.87 0.0002 body mass (VT:0001259) body weight (CMO:0000012) 1 197697768 242697768 Rat 1354652 Kidm20 Kidney mass QTL 20 4.3 kidney mass (VT:0002707) calculated kidney weight (CMO:0000160) 1 177227632 256448636 Rat 2293674 Bss39 Bone structure and strength QTL 39 7.1 0.0001 femur strength trait (VT:0010010) femur total energy absorbed before break (CMO:0001677) 1 201554356 246554356 Rat 2302378 Insul11 Insulin level QTL 11 3.25 blood insulin amount (VT:0001560) serum insulin level (CMO:0000358) 1 144267353 251128347 Rat 61455 Niddm7 Non-insulin dependent diabetes mellitus QTL 7 5.5 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 1 214537555 238757011 Rat 61327 Eae7 Experimental allergic encephalomyelitis QTL 7 5.6 body mass (VT:0001259) change in body weight (CMO:0002045) 1 216255568 260522016 Rat 1600392 Bw123 Body weight QTL 123 0.001 body mass (VT:0001259) body weight (CMO:0000012) 1 223201027 260522016 Rat 7794788 Mcs32 Mammary carcinoma susceptibility QTL 32 2.61 mammary gland integrity trait (VT:0010552) mammary tumor incidence/prevalence measurement (CMO:0000946) 1 115540693 238914717 Rat 1578763 Kidm29 Kidney mass QTL 29 3.3 0.0001 kidney mass (VT:0002707) both kidneys wet weight (CMO:0000085) 1 179567751 260522016 Rat 1600395 Niddm69 Non-insulin dependent diabetes mellitus QTL 69 4.14 0.0002 blood insulin amount (VT:0001560) plasma insulin level (CMO:0000342) 1 195804352 257091168 Rat 1354624 Cm35 Cardiac mass QTL35 5.7 heart left ventricle mass (VT:0007031) calculated heart weight (CMO:0000073) 1 177227632 256448636 Rat 1600396 Niddm68 Non-insulin dependent diabetes mellitus QTL 68 4.97 0.0003 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 1 195804352 257091168 Rat 1600397 Edcs4 Endometrial carcinoma susceptibility QTL 4 2.2 uterus morphology trait (VT:0001120) percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759) 1 206081677 251081677 Rat 1549837 Hcar15 Hepatocarcinoma resistance QTL 15 0.05 liver integrity trait (VT:0010547) liver tumorous lesion number (CMO:0001068) 1 153136852 260522016 Rat 152025235 Bw194 Body weight QTL 194 4.86 body mass (VT:0001259) 1 123556856 242907031 Rat 1600388 Niddm67 Non-insulin dependent diabetes mellitus QTL 67 5.84 0.000004 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 1 195804352 257091168 Rat 2293694 Bss38 Bone structure and strength QTL 38 7.05 0.0001 femur strength trait (VT:0010010) femur stiffness (CMO:0001674) 1 201554356 246554356 Rat 1578759 Uae30 Urinary albumin excretion QTL 30 3.3 0.003 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 1 150700247 252085048 Rat 1300108 Rf8 Renal function QTL 8 3.75 renal blood flow trait (VT:2000006) absolute change in renal vascular resistance (CMO:0001900) 1 228581588 259647894 Rat 8655655 Arrd2 Age-related retinal degeneration QTL 2 7.79 retinal layer morphology trait (VT:0003727) percentage of study population developing retinopathy during a period of time (CMO:0002453) 1 183970203 243914901 Rat 734767 Niddm57 Non-insulin dependent diabetes mellitus QTL 57 body mass (VT:0001259) body weight (CMO:0000012) 1 224054293 260122809 Rat 1358898 Bp255 Blood pressure QTL 255 3.6 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 191019702 246062233 Rat 631215 Stl8 Serum triglyceride level QTL 8 9.27 0.0001 blood triglyceride amount (VT:0002644) serum triglyceride level (CMO:0000360) 1 225126575 260522016 Rat 631843 Bw116 Body weight QTL 116 4.1 0.016 abdominal adipose amount (VT:1000220) abdominal fat pad weight (CMO:0000088) 1 224054293 260122809 Rat 2300175 Bmd40 Bone mineral density QTL 40 15.4 0.0001 femur mineral mass (VT:0010011) bone mineral density (CMO:0001226) 1 201554356 246554356 Rat 731175 Uae20 Urinary albumin excretion QTL 20 3.5 0.0018 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 1 221264111 259647894 Rat 1354661 Bw33 Body weight QTL 33 5.2 body mass (VT:0001259) body weight (CMO:0000012) 1 151162512 256448636 Rat 724538 Kidm1 Kidney mass QTL 1 3.2 kidney mass (VT:0002707) calculated kidney weight (CMO:0000160) 1 213707201 252085212 Rat 2293655 Bss36 Bone structure and strength QTL 36 10.66 0.0001 femur strength trait (VT:0010010) femur ultimate force (CMO:0001675) 1 201554356 246554356 Rat 1298084 Thym4 Thymus enlargement QTL 4 10.68 thymus mass (VT:0004954) thymus weight to body weight ratio (CMO:0000612) 1 197814409 242814409 Rat 724531 Uae5 Urinary albumin excretion QTL 5 4 urine albumin amount (VT:0002871) urine albumin level (CMO:0000130) 1 150700142 252085212 Rat 8552891 Epfw5 Epididymal fat weight QTL 5 4.4 epididymal fat pad mass (VT:0010421) epididymal fat pad weight to body weight ratio (CMO:0000658) 1 193113876 238113876 Rat 734769 Niddm58 Non-insulin dependent diabetes mellitus QTL 58 body mass (VT:0001259) body weight (CMO:0000012) 1 224569538 260122809 Rat 734768 Niddm59 Non-insulin dependent diabetes mellitus QTL 59 body mass (VT:0001259) body weight (CMO:0000012) 1 213843987 258843987 Rat 1358890 Bp259 Blood pressure QTL 259 3.06 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 210702053 260522016 Rat 724533 Rf51 Renal function QTL 51 5.3 0.0002 kidney plasma flow trait (VT:0005524) renal plasma flow (CMO:0001914) 1 218753816 256448513 Rat 1354580 Scort1 Serum corticosterone level QTL 1 3.4 blood corticosterone amount (VT:0005345) blood corticosterone level (CMO:0001172) 1 156677124 256448636 Rat 1358292 Cm37 Cardiac mass QTL 37 6.2 8e-07 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 1 196248093 241248093 Rat 61376 Bp42 Blood pressure QTL 42 23.4 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 197814409 242814409 Rat 634313 Niddm43 Non-insulin dependent diabetes mellitus QTL 43 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 1 199050459 259647894 Rat 1549910 Bw54 Body weight QTL 54 0.05 body mass (VT:0001259) body weight (CMO:0000012) 1 214647894 259647894 Rat 70211 Niddm24 Non-insulin dependent diabetes mellitus QTL 24 3.79 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 1 214647894 259647894 Rat 1357399 Bw45 Body weight QTL 45 3.05 body mass (VT:0001259) body mass index (BMI) (CMO:0000105) 1 206329708 251329708 Rat 724552 Glom2 Glomerulus QTL 2 3.3 0.0001 kidney glomerulus morphology trait (VT:0005325) count of superficial glomeruli directly contacting the kidney surface (CMO:0001001) 1 222363780 260522016 Rat 2316896 Gluco57 Glucose level QTL 57 7.2 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 1 228985440 245907899 Rat 1357404 Bw42 Body weight QTL 42 4.49 0.0001 body mass (VT:0001259) body weight (CMO:0000012) 1 206329708 251329708 Rat 10053715 Scort24 Serum corticosterone level QTL 24 2.13 0.0088 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 1 221414816 260522016 Rat 7421630 Bp362 Blood pressure QTL 362 0.001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 118608292 241799120 Rat 1358916 Kidm22 Kidney mass QTL 22 3.32 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 1 210702053 240947965 Rat 634321 Hc1 Hypercalciuria QTL 1 2.91 urine calcium amount (VT:0002985) urine calcium excretion rate (CMO:0000763) 1 178810256 240830002 Rat 61400 Niddm1 Non-insulin dependent diabetes mellitus QTL 1 11 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 1 218753689 245907899 Rat 10059587 Bw173 Body weight QTL 173 3.23 0.025 body mass (VT:0001259) body weight (CMO:0000012) 1 202069611 247069611 Rat 2292216 Bw80 Body weight QTL 80 3.23 0.0019 body mass (VT:0001259) body weight (CMO:0000012) 1 213533809 243914901 Rat 2292220 Bp306 Blood pressure QTL 306 3.47 0.00087 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 164310393 243914901 Rat 10059590 Kidm44 Kidney mass QTL 44 3.42 0.025 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 1 191033875 236033875 Rat 1641926 Teswt2 Testicular weight QTL 2 2.82 testis mass (VT:1000644) both testes wet weight (CMO:0000175) 1 197697768 238755659 Rat 631658 Cm7 Cardiac mass QTL 7 5.32 0.0001 aorta mass (VT:0002845) aorta weight (CMO:0000076) 1 196248093 241248093 Rat 1354610 Bw34 Body weight QTL 34 4.1 body mass (VT:0001259) body weight (CMO:0000012) 1 151162512 256448636 Rat 2293700 Bmd27 Bone mineral density QTL 27 6.6 0.0001 femur mineral mass (VT:0010011) trabecular volumetric bone mineral density (CMO:0001729) 1 224054293 243747962 Rat 2293701 Bmd34 Bone mineral density QTL 34 8.3 0.0001 femur strength trait (VT:0010010) femoral neck ultimate force (CMO:0001703) 1 224054293 243747962 Rat 7387289 Uae45 Urinary albumin excretion QTL 45 2.86 0.0021 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 1 223262787 260522016 Rat 8655855 Arrd3 Age-related retinal degeneration QTL 3 3.07 lens clarity trait (VT:0001304) cataract incidence/prevalence measurement (CMO:0001585) 1 183970203 243914901 Rat 1600374 Mcs17 Mammary carcinoma susceptibility QTL 17 3 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 1 197670404 242670404 Rat 1600363 Hc6 Hypercalciuria QTL 6 2.7 urine calcium amount (VT:0002985) urine calcium excretion rate (CMO:0000763) 1 203995416 244113296 Rat 738032 Hcas5 Hepatocarcinoma susceptibility QTL 5 3.12 liver integrity trait (VT:0010547) liver tumorous lesion number (CMO:0001068) 1 176426412 257976495 Rat 1358191 Ept10 Estrogen-induced pituitary tumorigenesis QTL 10 3.8 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 1 192825253 243914732 Rat 2302040 Pia35 Pristane induced arthritis QTL 35 3.8 0.001 blood immunoglobulin amount (VT:0002460) serum immunoglobulin G1 level (CMO:0002115) 1 216255568 260522016 Rat 7394701 Uae46 Urinary albumin excretion QTL 46 3.6 0.0056 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 1 201554356 246554356 Rat 1598821 Rf55 Renal function QTL 55 6.3 renal blood flow trait (VT:2000006) ratio of change in renal blood flow to change in renal perfusion pressure (CMO:0001239) 1 218748008 257976495 Rat
AI169398
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 1 232,015,144 - 232,015,348 (+) MAPPER mRatBN7.2 Rnor_6.0 1 252,807,330 - 252,807,533 NCBI Rnor6.0 Rnor_5.0 1 260,028,974 - 260,029,177 UniSTS Rnor5.0 RGSC_v3.4 1 238,457,285 - 238,457,488 UniSTS RGSC3.4 Celera 1 229,127,718 - 229,127,921 UniSTS RH 3.4 Map 1 1591.0 UniSTS Cytogenetic Map 1 q52 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
56
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000025856 ⟹ ENSRNOP00000025856
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 1 232,014,880 - 232,016,195 (-) Ensembl Rnor_6.0 Ensembl 1 252,807,065 - 252,808,380 (-) Ensembl
RefSeq Acc Id:
NM_001025415 ⟹ NP_001020586
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 241,428,048 - 241,429,366 (-) NCBI mRatBN7.2 1 232,014,877 - 232,016,195 (-) NCBI Rnor_6.0 1 252,807,062 - 252,808,380 (-) NCBI Rnor_5.0 1 260,028,706 - 260,035,142 (-) NCBI RGSC_v3.4 1 238,457,017 - 238,458,335 (-) RGD Celera 1 229,127,450 - 229,128,768 (-) RGD
Sequence:
TCAGCATGGCCTGCCACAACGTTTCGGAGCTCCAAGACCTTGGTTGTTCCAACCAGCTGCTCCTGCAGCCTCTCTGGGACAGCATAAGGACGGGAGAGGCGTCCGCGCGCTCACCCTTCTTCCCAGTC
hide sequence
RefSeq Acc Id:
NP_001020586 ⟸ NM_001025415
- UniProtKB:
Q4QQV7 (UniProtKB/Swiss-Prot), A6I129 (UniProtKB/TrEMBL)
- Sequence:
MACHNVSELQDLGCSNQLLLQPLWDSIRTGEASARSPFFPVIFSIFTYLGFCLPFVVLDVLCPWVPILRRYKIHPDFSPSVRQLLPCLGLTLYQHLVFVFPVTLMHWARSPALLPREAPELSQLLSHV
hide sequence
Ensembl Acc Id:
ENSRNOP00000025856 ⟸ ENSRNOT00000025856
RGD ID: 13690865 Promoter ID: EPDNEW_R1388 Type: single initiation site Name: Ch25h_1 Description: cholesterol 25-hydroxylase SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 1 252,808,396 - 252,808,456 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2005-12-06
Ch25h
cholesterol 25-hydroxylase
Ch25h_predicted
cholesterol 25-hydroxylase (predicted)
Symbol and Name updated
1559027 APPROVED
2005-01-12
Ch25h_predicted
cholesterol 25-hydroxylase (predicted)
Symbol and Name status set to approved
70820 APPROVED
