Ndufc2<sup>em2Mcwi</sup> (NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2; zinc finger nuclease induced mutant 2, Medical College of Wisconsin) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: Ndufc2em2Mcwi (NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2; zinc finger nuclease induced mutant 2, Medical College of Wisconsin) Rattus norvegicus
Analyze
Symbol: Ndufc2em2Mcwi
Name: NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2; zinc finger nuclease induced mutant 2, Medical College of Wisconsin
RGD ID: 9588541
Description: This allele was made by ZFN mutagenesis. The resulting mutation is 111-bp deletion in the genome and 4-bp insertion (TTGT) in the deletion site, net 107-bp deletion in exon 1.
ASSOCIATED WITH failure of embryo implantation; increased urine protein level; ASSOCIATED WITH Stroke
Type: allele  of Ndufc2  
Previously known as: Ndufc2^[em2Mcwi]; Ndufc2em2Mcwi
Is Marker For: Strains:   SHR-Ndufc2em2Mcwi  
Latest Assembly: GRCr8 - GRCr8 Assembly
Position: No map positions available.


Disease Annotations     Click to see Annotation Detail View
Stroke  (IMP)

Phenotype Annotations     Click to see Annotation Detail View

Mammalian Phenotype
References

References - curated
# Reference Title Reference Citation
1. Knockout rats via embryo microinjection of zinc-finger nucleases. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. PhysGen Knockouts PhysGen Knockout strains
3. Ndufc2 Gene Inhibition Is Associated With Mitochondrial Dysfunction and Increased Stroke Susceptibility in an Animal Model of Complex Human Disease. Rubattu S, etal., J Am Heart Assoc. 2016 Feb 17;5(2). pii: e002701. doi: 10.1161/JAHA.115.002701.

Genomics

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Ndufc2em2Mcwi-var1 chr1 151712052 151712162 CCGGGCCATGAGCCCTTAAGATTCTTGCCGGATGAGGCCCGGAGACTGCCCCCGCCCAAGCTGAACGACCCGCGGCTTGTCTACATCGGCTTCCTGGGCTACTGCACGGGC TTGT delins mRatBN7.2

Related Rat Strains
The following Strains have been annotated to Ndufc2em2Mcwi


Expression

RNA-SEQ Expression


Sequence

Nucleotide Sequences
RefSeq Transcripts NM_001009290 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information