Ndufc2<sup>em2Mcwi</sup> (NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2; zinc finger nuclease induced mutant 2, Medical College of Wisconsin) - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Gene: Ndufc2em2Mcwi (NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2; zinc finger nuclease induced mutant 2, Medical College of Wisconsin) Rattus norvegicus
Analyze
Symbol: Ndufc2em2Mcwi
Name: NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2; zinc finger nuclease induced mutant 2, Medical College of Wisconsin
RGD ID: 9588541
Description: This allele was made by ZFN mutagenesis. The resulting mutation is 111-bp deletion in the genome and 4-bp insertion (TTGT) in the deletion site, net 107-bp deletion in exon 1.
ASSOCIATED WITH failure of embryo implantation; increased urine protein level; ASSOCIATED WITH Stroke
Type: allele  of Ndufc2  
Previously known as: Ndufc2^[em2Mcwi]; Ndufc2em2Mcwi
Is Marker For: Strains:   SHR-Ndufc2em2Mcwi  
Latest Assembly: mRatBN7.2 - mRatBN7.2 Assembly
Position: No map positions available.


Disease Annotations     Click to see Annotation Detail View
Stroke  (IMP)

Phenotype Annotations     Click to see Annotation Detail View

Mammalian Phenotype
References

References - curated
# Reference Title Reference Citation
1. Knockout rats via embryo microinjection of zinc-finger nucleases. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. PhysGen Knockouts PhysGen Knockout strains
3. Ndufc2 Gene Inhibition Is Associated With Mitochondrial Dysfunction and Increased Stroke Susceptibility in an Animal Model of Complex Human Disease. Rubattu S, etal., J Am Heart Assoc. 2016 Feb 17;5(2). pii: e002701. doi: 10.1161/JAHA.115.002701.

Genomics

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Ndufc2em2Mcwi-var1 chr1 151712052 151712162 CCGGGCCATGAGCCCTTAAGATTCTTGCCGGATGAGGCCCGGAGACTGCCCCCGCCCAAGCTGAACGACCCGCGGCTTGTCTACATCGGCTTCCTGGGCTACTGCACGGGC TTGT delins mRatBN7.2

Related Rat Strains
The following Strains have been annotated to Ndufc2em2Mcwi
SHR-Ndufc2em2Mcwi    


Expression


Sequence

Nucleotide Sequences
RefSeq Transcripts NM_001009290 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information