Symbol:
Mark1
Name:
MAP/microtubule affinity regulating kinase 1
RGD ID:
732242
MGI Page
MGI
Description:
Predicted to enable several functions, including ATP binding activity; magnesium ion binding activity; and phospholipid binding activity. Involved in establishment of mitochondrion localization; regulation of dendrite development; and regulation of postsynapse assembly. Is active in glutamatergic synapse and postsynapse. Is expressed in dorsal root ganglion; facial ganglion; glossopharyngeal ganglion; and trigeminal ganglion. Orthologous to human MARK1 (microtubule affinity regulating kinase 1).
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
AW491150; B930025N23Rik; ELKL motif serine-threonine protein kinase 3; ELKL motif serine/threonine-protein kinase 3; Emk3; KIAA1477; MAP/microtubule affinity-regulating kinase 1; mKIAA1477; mPar-1c; Par-1c; PAR1 homolog c; serine/threonine-protein kinase MARK1
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
MARK1 (microtubule affinity regulating kinase 1) HGNC
EggNOG, Ensembl, HGNC, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, Treefam
Rattus norvegicus (Norway rat):
Mark1 (microtubule affinity regulating kinase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Mark1 (microtubule affinity regulating kinase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
MARK1 (microtubule affinity regulating kinase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
MARK1 (microtubule affinity regulating kinase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Mark1 (microtubule affinity regulating kinase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
MARK1 (microtubule affinity regulating kinase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
MARK1 (microtubule affinity regulating kinase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Mark1 (microtubule affinity regulating kinase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Other homologs 2
Homo sapiens (human):
MARK4 (microtubule affinity regulating kinase 4) HGNC
OrthoMCL
Homo sapiens (human):
MARK2 (microtubule affinity regulating kinase 2) HGNC
OrthoMCL
Homo sapiens (human):
MARK3 (microtubule affinity regulating kinase 3) HGNC
OrthoMCL
Alliance orthologs 3
Rattus norvegicus (Norway rat):
Mark1 (microtubule affinity regulating kinase 1)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Homo sapiens (human):
MARK1 (microtubule affinity regulating kinase 1)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
mark1 (MAP/microtubule affinity-regulating kinase 1)
Alliance
DIOPT (Ensembl Compara|OMA|OrthoFinder|PANTHER|PhylomeDB)
Caenorhabditis elegans (roundworm):
par-1
Alliance
DIOPT (Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Drosophila melanogaster (fruit fly):
par-1
Alliance
DIOPT (Hieranoid|InParanoid|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Related Pseudogenes:
Mark1-ps1
Mark1-ps2
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 1 184,628,621 - 184,732,152 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 1 184,628,986 - 184,731,767 (-) Ensembl GRCm39 Ensembl GRCm38 1 184,896,424 - 184,999,954 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 1 184,896,789 - 184,999,570 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 1 186,720,303 - 186,823,428 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 1 186,598,391 - 186,700,267 (-) NCBI MGSCv36 mm8 Celera 1 191,860,242 - 191,963,269 (-) NCBI Celera Cytogenetic Map 1 H5 NCBI cM Map 1 89.26 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Mark1 Mouse 1,1-dichloroethene increases expression EXP 6480464 vinylidene chloride results in increased expression of MARK1 mRNA CTD PMID:26682919 Mark1 Mouse 1,2-dimethylhydrazine decreases expression EXP 6480464 1 and 2-Dimethylhydrazine results in decreased expression of MARK1 mRNA CTD PMID:22206623 Mark1 Mouse 17alpha-ethynylestradiol multiple interactions EXP 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of MARK1 mRNA CTD PMID:17942748 Mark1 Mouse 17beta-estradiol increases expression EXP 6480464 Estradiol results in increased expression of MARK1 mRNA CTD PMID:19484750 Mark1 Mouse 2,3,7,8-tetrachlorodibenzodioxine multiple interactions EXP 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of MARK1 mRNA CTD PMID:17942748 Mark1 Mouse 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO Mark1 (Rattus norvegicus) 6480464 Tetrachlorodibenzodioxin results in decreased expression of MARK1 mRNA CTD PMID:33387578 Mark1 Mouse 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Mark1 (Rattus norvegicus) 6480464 Tetrachlorodibenzodioxin affects the expression of MARK1 mRNA CTD PMID:34747641 Mark1 Mouse 4,4'-sulfonyldiphenol multiple interactions ISO Mark1 (Rattus norvegicus) 6480464 [bisphenol A co-treated with bisphenol F co-treated with bisphenol S] results in decreased expression of MARK1 mRNA CTD PMID:36041667 Mark1 Mouse 4-hydroxyphenyl retinamide increases expression EXP 6480464 Fenretinide results in increased expression of MARK1 mRNA CTD PMID:28973697 Mark1 Mouse 5-aza-2'-deoxycytidine increases expression ISO MARK1 (Homo sapiens) 6480464 Decitabine results in increased expression of MARK1 mRNA CTD PMID:16367923 Mark1 Mouse 6-propyl-2-thiouracil increases expression ISO Mark1 (Rattus norvegicus) 6480464 Propylthiouracil results in increased expression of MARK1 mRNA CTD PMID:30047161 Mark1 Mouse 9-cis-retinoic acid increases expression ISO Mark1 (Rattus norvegicus) 6480464 Alitretinoin results in increased expression of MARK1 mRNA CTD PMID:16648578 Mark1 Mouse acetamide increases expression ISO Mark1 (Rattus norvegicus) 6480464 acetamide results in increased expression of MARK1 mRNA CTD PMID:31881176 Mark1 Mouse allethrin multiple interactions ISO Mark1 (Rattus norvegicus) 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in decreased expression of MARK1 protein CTD PMID:34896426 Mark1 Mouse amitrole increases expression ISO Mark1 (Rattus norvegicus) 6480464 Amitrole results in increased expression of MARK1 mRNA CTD PMID:30047161 Mark1 Mouse ammonium chloride affects expression ISO Mark1 (Rattus norvegicus) 6480464 Ammonium Chloride affects the expression of MARK1 mRNA CTD PMID:16483693 Mark1 Mouse antirheumatic drug increases expression ISO MARK1 (Homo sapiens) 6480464 Antirheumatic Agents results in increased expression of MARK1 mRNA CTD PMID:24449571 Mark1 Mouse arsenite(3-) decreases expression ISO MARK1 (Homo sapiens) 6480464 arsenite results in decreased expression of MARK1 mRNA CTD PMID:23974009 Mark1 Mouse atrazine decreases expression ISO MARK1 (Homo sapiens) 6480464 Atrazine results in decreased expression of MARK1 mRNA CTD PMID:22378314 Mark1 Mouse beta-lapachone increases expression ISO MARK1 (Homo sapiens) 6480464 beta-lapachone results in increased expression of MARK1 mRNA CTD PMID:38218311 Mark1 Mouse bexarotene increases expression ISO Mark1 (Rattus norvegicus) 6480464 bexarotene results in increased expression of MARK1 mRNA CTD PMID:16648578 Mark1 Mouse bisphenol A decreases expression ISO MARK1 (Homo sapiens) 6480464 bisphenol A results in decreased expression of MARK1 mRNA CTD PMID:22576693 Mark1 Mouse bisphenol A multiple interactions ISO Mark1 (Rattus norvegicus) 6480464 [bisphenol A co-treated with bisphenol F co-treated with bisphenol S] results in decreased expression of MARK1 mRNA CTD PMID:36041667 Mark1 Mouse bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of MARK1 mRNA CTD PMID:32156529 Mark1 Mouse bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of MARK1 mRNA CTD PMID:25594700 Mark1 Mouse bisphenol A increases expression ISO Mark1 (Rattus norvegicus) 6480464 bisphenol A results in increased expression of MARK1 mRNA CTD PMID:25181051 and PMID:30816183 Mark1 Mouse bisphenol A increases methylation ISO MARK1 (Homo sapiens) 6480464 bisphenol A results in increased methylation of MARK1 gene CTD PMID:22576693 and PMID:31601247 Mark1 Mouse bisphenol F multiple interactions ISO Mark1 (Rattus norvegicus) 6480464 [bisphenol A co-treated with bisphenol F co-treated with bisphenol S] results in decreased expression of MARK1 mRNA CTD PMID:36041667 Mark1 Mouse cadmium atom multiple interactions EXP 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of MARK1 mRNA CTD PMID:37325564 Mark1 Mouse cadmium dichloride multiple interactions EXP 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of MARK1 mRNA CTD PMID:37325564 Mark1 Mouse carbon nanotube increases expression EXP 6480464 Nanotubes more ... CTD PMID:25554681 Mark1 Mouse CGP 52608 multiple interactions ISO MARK1 (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to MARK1 gene] CTD PMID:28238834 Mark1 Mouse choline multiple interactions EXP 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased methylation of MARK1 gene CTD PMID:20938992 Mark1 Mouse cisplatin decreases expression ISO MARK1 (Homo sapiens) 6480464 Cisplatin results in decreased expression of MARK1 mRNA CTD PMID:27392435 Mark1 Mouse cisplatin multiple interactions ISO MARK1 (Homo sapiens) 6480464 [Cisplatin co-treated with jinfukang] results in decreased expression of MARK1 mRNA CTD PMID:27392435 Mark1 Mouse cocaine affects expression ISO Mark1 (Rattus norvegicus) 6480464 Cocaine affects the expression of MARK1 mRNA CTD PMID:20187946 Mark1 Mouse cyclosporin A increases expression ISO MARK1 (Homo sapiens) 6480464 Cyclosporine results in increased expression of MARK1 mRNA CTD PMID:20106945 Mark1 Mouse cyhalothrin multiple interactions ISO Mark1 (Rattus norvegicus) 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in decreased expression of MARK1 protein CTD PMID:34896426 Mark1 Mouse cypermethrin multiple interactions ISO Mark1 (Rattus norvegicus) 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in decreased expression of MARK1 protein CTD PMID:34896426 Mark1 Mouse dibutyl phthalate increases expression ISO Mark1 (Rattus norvegicus) 6480464 Dibutyl Phthalate results in increased expression of MARK1 mRNA CTD PMID:21266533 Mark1 Mouse dibutyl phthalate multiple interactions ISO MARK1 (Homo sapiens) 6480464 [Dibutyl Phthalate co-treated with Tetradecanoylphorbol Acetate] results in decreased expression of MARK1 protein CTD PMID:30218697 Mark1 Mouse doxorubicin decreases expression ISO MARK1 (Homo sapiens) 6480464 Doxorubicin results in decreased expression of MARK1 mRNA CTD PMID:29803840 Mark1 Mouse entinostat decreases expression ISO MARK1 (Homo sapiens) 6480464 entinostat results in decreased expression of MARK1 mRNA CTD PMID:27188386 Mark1 Mouse ethanol affects splicing EXP 6480464 Ethanol affects the splicing of MARK1 mRNA CTD PMID:30319688 Mark1 Mouse fenvalerate multiple interactions ISO Mark1 (Rattus norvegicus) 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in decreased expression of MARK1 protein CTD PMID:34896426 Mark1 Mouse fipronil increases expression ISO Mark1 (Rattus norvegicus) 6480464 fipronil results in increased expression of MARK1 mRNA CTD PMID:31881178 Mark1 Mouse folic acid multiple interactions EXP 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased methylation of MARK1 gene CTD PMID:20938992 Mark1 Mouse FR900359 affects phosphorylation ISO MARK1 (Homo sapiens) 6480464 FR900359 affects the phosphorylation of MARK1 protein CTD PMID:37730182 Mark1 Mouse glyphosate affects methylation ISO Mark1 (Rattus norvegicus) 6480464 Glyphosate affects the methylation of MARK1 gene CTD PMID:35440735 Mark1 Mouse L-methionine multiple interactions EXP 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased methylation of MARK1 gene CTD PMID:20938992 Mark1 Mouse lipopolysaccharide multiple interactions ISO MARK1 (Homo sapiens) 6480464 S-(1 and 2-dichlorovinyl)cysteine inhibits the reaction [Lipopolysaccharides results in increased expression of MARK1 mRNA] CTD PMID:35811015 Mark1 Mouse lipopolysaccharide increases expression ISO MARK1 (Homo sapiens) 6480464 Lipopolysaccharides results in increased expression of MARK1 mRNA CTD PMID:35811015 Mark1 Mouse methimazole increases expression ISO Mark1 (Rattus norvegicus) 6480464 Methimazole results in increased expression of MARK1 mRNA CTD PMID:30047161 Mark1 Mouse methylmercury chloride decreases expression ISO MARK1 (Homo sapiens) 6480464 methylmercuric chloride results in decreased expression of MARK1 mRNA CTD PMID:28001369 Mark1 Mouse nickel atom affects expression ISO MARK1 (Homo sapiens) 6480464 Nickel affects the expression of MARK1 mRNA CTD PMID:14575637 Mark1 Mouse nickel atom decreases expression ISO MARK1 (Homo sapiens) 6480464 Nickel results in decreased expression of MARK1 mRNA CTD PMID:25583101 Mark1 Mouse nickel atom multiple interactions ISO MARK1 (Homo sapiens) 6480464 trichostatin A inhibits the reaction [Nickel affects the expression of MARK1 mRNA] CTD PMID:14575637 Mark1 Mouse okadaic acid increases expression ISO MARK1 (Homo sapiens) 6480464 Okadaic Acid results in increased expression of MARK1 mRNA CTD PMID:38832940 Mark1 Mouse paracetamol affects expression EXP 6480464 Acetaminophen affects the expression of MARK1 mRNA CTD PMID:17562736 Mark1 Mouse paracetamol decreases expression ISO Mark1 (Rattus norvegicus) 6480464 Acetaminophen results in decreased expression of MARK1 mRNA CTD PMID:33387578 Mark1 Mouse phenylarsine oxide increases activity ISO MARK1 (Homo sapiens) 6480464 oxophenylarsine results in increased activity of MARK1 protein CTD PMID:10737602 Mark1 Mouse phenylarsine oxide multiple interactions ISO MARK1 (Homo sapiens) 6480464 [oxophenylarsine results in increased activity of MARK1 protein] which results in increased phosphorylation of MAPT protein and Staurosporine inhibits the reaction [oxophenylarsine results in increased activity of MARK1 protein] CTD PMID:10737602 Mark1 Mouse phorbol 13-acetate 12-myristate multiple interactions ISO MARK1 (Homo sapiens) 6480464 [Dibutyl Phthalate co-treated with Tetradecanoylphorbol Acetate] results in decreased expression of MARK1 protein CTD PMID:30218697 Mark1 Mouse potassium chromate increases expression ISO MARK1 (Homo sapiens) 6480464 potassium chromate(VI) results in increased expression of MARK1 mRNA CTD PMID:22714537 Mark1 Mouse pyrethrins decreases expression ISO Mark1 (Rattus norvegicus) 6480464 Pyrethrins results in decreased expression of MARK1 protein CTD PMID:34896426 Mark1 Mouse rotenone increases expression EXP 6480464 Rotenone results in increased expression of MARK1 mRNA CTD PMID:32937126 Mark1 Mouse S-(1,2-dichlorovinyl)-L-cysteine multiple interactions ISO MARK1 (Homo sapiens) 6480464 S-(1 and 2-dichlorovinyl)cysteine inhibits the reaction [Lipopolysaccharides results in increased expression of MARK1 mRNA] CTD PMID:35811015 Mark1 Mouse sodium arsenite increases expression ISO MARK1 (Homo sapiens) 6480464 sodium arsenite results in increased expression of MARK1 mRNA CTD PMID:38568856 Mark1 Mouse staurosporine multiple interactions ISO MARK1 (Homo sapiens) 6480464 Staurosporine inhibits the reaction [oxophenylarsine results in increased activity of MARK1 protein] CTD PMID:10737602 Mark1 Mouse sulfadimethoxine increases expression ISO Mark1 (Rattus norvegicus) 6480464 Sulfadimethoxine results in increased expression of MARK1 mRNA CTD PMID:30047161 Mark1 Mouse sunitinib increases expression ISO MARK1 (Homo sapiens) 6480464 Sunitinib results in increased expression of MARK1 mRNA CTD PMID:31533062 Mark1 Mouse tamoxifen increases expression EXP 6480464 Tamoxifen results in increased expression of MARK1 mRNA CTD PMID:25123088 Mark1 Mouse tetrachloromethane affects expression EXP 6480464 Carbon Tetrachloride affects the expression of MARK1 mRNA CTD PMID:17484886 Mark1 Mouse thioacetamide increases expression ISO Mark1 (Rattus norvegicus) 6480464 Thioacetamide results in increased expression of MARK1 mRNA CTD PMID:34492290 Mark1 Mouse trichostatin A multiple interactions ISO MARK1 (Homo sapiens) 6480464 trichostatin A inhibits the reaction [Nickel affects the expression of MARK1 mRNA] CTD PMID:14575637 Mark1 Mouse trichostatin A increases expression ISO MARK1 (Homo sapiens) 6480464 trichostatin A results in increased expression of MARK1 mRNA CTD PMID:24935251 Mark1 Mouse valproic acid decreases methylation ISO MARK1 (Homo sapiens) 6480464 Valproic Acid results in decreased methylation of MARK1 gene CTD PMID:29154799 Mark1 Mouse valproic acid increases expression ISO MARK1 (Homo sapiens) 6480464 Valproic Acid results in increased expression of MARK1 mRNA CTD PMID:23179753 Mark1 Mouse valproic acid affects expression ISO MARK1 (Homo sapiens) 6480464 Valproic Acid affects the expression of MARK1 mRNA CTD PMID:25979313 Mark1 Mouse valproic acid decreases expression ISO MARK1 (Homo sapiens) 6480464 Valproic Acid results in decreased expression of MARK1 mRNA CTD PMID:28001369
1,1-dichloroethene (EXP) 1,2-dimethylhydrazine (EXP) 17alpha-ethynylestradiol (EXP) 17beta-estradiol (EXP) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 4,4'-sulfonyldiphenol (ISO) 4-hydroxyphenyl retinamide (EXP) 5-aza-2'-deoxycytidine (ISO) 6-propyl-2-thiouracil (ISO) 9-cis-retinoic acid (ISO) acetamide (ISO) allethrin (ISO) amitrole (ISO) ammonium chloride (ISO) antirheumatic drug (ISO) arsenite(3-) (ISO) atrazine (ISO) beta-lapachone (ISO) bexarotene (ISO) bisphenol A (EXP,ISO) bisphenol F (ISO) cadmium atom (EXP) cadmium dichloride (EXP) carbon nanotube (EXP) CGP 52608 (ISO) choline (EXP) cisplatin (ISO) cocaine (ISO) cyclosporin A (ISO) cyhalothrin (ISO) cypermethrin (ISO) dibutyl phthalate (ISO) doxorubicin (ISO) entinostat (ISO) ethanol (EXP) fenvalerate (ISO) fipronil (ISO) folic acid (EXP) FR900359 (ISO) glyphosate (ISO) L-methionine (EXP) lipopolysaccharide (ISO) methimazole (ISO) methylmercury chloride (ISO) nickel atom (ISO) okadaic acid (ISO) paracetamol (EXP,ISO) phenylarsine oxide (ISO) phorbol 13-acetate 12-myristate (ISO) potassium chromate (ISO) pyrethrins (ISO) rotenone (EXP) S-(1,2-dichlorovinyl)-L-cysteine (ISO) sodium arsenite (ISO) staurosporine (ISO) sulfadimethoxine (ISO) sunitinib (ISO) tamoxifen (EXP) tetrachloromethane (EXP) thioacetamide (ISO) trichostatin A (ISO) valproic acid (ISO)
Mark1 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 1 184,628,621 - 184,732,152 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 1 184,628,986 - 184,731,767 (-) Ensembl GRCm39 Ensembl GRCm38 1 184,896,424 - 184,999,954 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 1 184,896,789 - 184,999,570 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 1 186,720,303 - 186,823,428 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 1 186,598,391 - 186,700,267 (-) NCBI MGSCv36 mm8 Celera 1 191,860,242 - 191,963,269 (-) NCBI Celera Cytogenetic Map 1 H5 NCBI cM Map 1 89.26 NCBI
MARK1 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 1 220,528,136 - 220,664,461 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 1 220,528,136 - 220,664,461 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 1 220,701,478 - 220,837,803 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 1 218,768,191 - 218,904,422 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 1 217,089,962 - 217,225,667 NCBI Celera 1 193,920,723 - 194,057,269 (+) NCBI Celera Cytogenetic Map 1 q41 NCBI HuRef 1 191,375,808 - 191,512,424 (+) NCBI HuRef CHM1_1 1 221,974,021 - 222,110,252 (+) NCBI CHM1_1 T2T-CHM13v2.0 1 219,767,527 - 219,904,166 (+) NCBI T2T-CHM13v2.0
Mark1 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 13 98,981,727 - 99,086,998 (-) NCBI GRCr8 mRatBN7.2 13 96,450,189 - 96,555,304 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 13 96,451,487 - 96,555,173 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 13 98,957,791 - 99,061,914 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 13 100,356,587 - 100,460,278 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 13 97,540,024 - 97,644,155 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 13 102,808,254 - 102,942,863 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 13 102,808,253 - 102,942,863 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 13 107,485,344 - 107,589,704 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 13 100,905,369 - 101,009,161 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 13 101,094,411 - 101,198,263 (-) NCBI Celera 13 95,968,489 - 96,018,212 (-) NCBI Celera Cytogenetic Map 13 q26 NCBI
Mark1 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955520 3,086,887 - 3,205,525 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955520 3,087,581 - 3,205,525 (-) NCBI ChiLan1.0 ChiLan1.0
MARK1 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 1 28,735,310 - 28,871,788 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 1 28,697,135 - 28,833,583 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 1 196,114,714 - 196,251,166 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 1 201,150,316 - 201,286,201 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 1 201,150,310 - 201,286,201 (+) Ensembl panpan1.1 panPan2
MARK1 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 38 15,270,523 - 15,341,934 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 38 15,273,004 - 15,340,448 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 38 15,268,336 - 15,385,001 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 38 15,263,226 - 15,379,605 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 38 15,262,280 - 15,379,579 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 38 15,270,806 - 15,387,062 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 38 15,625,161 - 15,741,308 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 38 15,905,948 - 16,022,402 (+) NCBI UU_Cfam_GSD_1.0
Mark1 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024409344 56,357,812 - 56,419,056 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936650 1,605,487 - 1,667,297 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936650 1,607,480 - 1,672,591 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
MARK1
MARK1 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 25 8,876,945 - 9,019,780 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 25 8,879,201 - 9,019,598 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666055 9,155,904 - 9,298,871 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Mark1
.
Predicted Target Of
Count of predictions: 730 Count of miRNA genes: 457 Interacting mature miRNAs: 551 Transcripts: ENSMUST00000027929 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
11039528 Ccc3_m colitis susceptibility in the Collaborative Cross 3 (mouse) 1 3680142 195051546 Mouse 4141245 Cq2_m cholesterol QTL 2 (mouse) Not determined 1 157456299 191456436 Mouse 4141244 Bmd5c_m bone mineral density 5c (mouse) Not determined 155526796 189526897 Mouse 1558802 Skmw6_m skeletal muscle weight 6 (mouse) Not determined 1 167954584 195154279 Mouse 10412185 Hcs9_m hepatocarcinogenesis susceptibility 9 (mouse) Not determined 1 63854690 189303617 Mouse 13464138 Hdlq107_m HDL QTL 107 (mouse) 1 152132744 186132744 Mouse 1301652 Cpfd2_m cerebellum pattern fissures (mouse) Not determined 1 172303451 195154279 Mouse 12790987 Tgl5_m triglyceride 5 (mouse) 1 160097157 194097157 Mouse 13824984 Twq5_m testis weight QTL 5 (mouse) 1 3069992 184732197 Mouse 4142389 Scfr1_m stem cell frequency regulator 1 (mouse) Not determined 171632048 189303617 Mouse 1300888 Berr1_m berghei resistance locus 1 (mouse) Not determined 1 164143227 190534272 Mouse 12790988 Phdlc5_m plasma HDL cholesterol 5 (mouse) 9 160097157 194097157 Mouse 1301251 Scc3_m colon tumor susceptibility 3 (mouse) Not determined 1 168213823 195154279 Mouse 1301122 Cd8mts1_m CD8 T memory cell subset 1 (mouse) Not determined 1 155831765 189831892 Mouse 1301632 Bw8q1_m body weight at 8 weeks QTL 1 (mouse) Not determined 1 161201261 195154279 Mouse 4141483 Femwf7_m femur work to failure 7 (mouse) Not determined 167462514 195154279 Mouse 1302023 Orch4_m autoimmune orchitis resistance 4 (mouse) Not determined 1 175211318 195154279 Mouse 1300745 Gvhd1_m graft-versus-host disease 1 (mouse) Not determined 1 157456299 191456436 Mouse 10412162 Nobq3_m New Zealand obese QTL 3 (mouse) Not determined 1 103933405 191225397 Mouse 4141346 Skmw12_m skeletal muscle weight 12 (mouse) Not determined 150756737 184756922 Mouse 1301134 Bmd1_m bone mineral density 1 (mouse) Not determined 1 156602037 189303617 Mouse 1302158 Fembrs5_m femur breaking strength 5 (mouse) Not determined 1 167462514 195154279 Mouse 1301132 Mors1_m modifier of obesity related sterility 1 (mouse) Not determined 1 170379500 195154279 Mouse 1357620 Aaj1_m anxiety in A/J 1 (mouse) Not determined 1 180832317 191851043 Mouse 1357493 Lgaq3_m late growth adjusted QTL 3 (mouse) Not determined 1 150193673 188359312 Mouse 11251722 Ewc1_m ethanol withdrawal and consumption 1 (mouse) 1 152132744 186132744 Mouse 10043963 Obq25_m obesity QTL 25 (mouse) Not determined 1 154410512 188410512 Mouse 1301431 Pcho1_m plasma cholesterol 1 (mouse) Not determined 1 159262573 193262693 Mouse 1357618 Splq5_m spleen weight QTL 5 (mouse) Not determined 1 150193673 188359312 Mouse 1301301 Sle1_m systemic lupus erythmatosus susceptibility 1 (mouse) Not determined 1 152038741 186038913 Mouse 12904936 Edlmmq1_m extensor digitorum longus muscle mass QTL 1 (mouse) 1 155002940 189002940 Mouse 1301565 Mnotch_m modifier of Notch (mouse) Not determined 1 157456299 191456436 Mouse 1301309 Emo1_m emotionality 1 (mouse) Not determined 1 162977097 185994196 Mouse 1357732 Tbbmd1_m total body bone mineral density 1 (mouse) Not determined 1 171983110 195154279 Mouse 1301025 Lbw7_m lupus NZB x NZW 7 (mouse) Not determined 1 152038741 186038913 Mouse 10412074 Nhdlt1_m non-HDL cholesterol and triglyceride levels 1 (mouse) Not determined 1 153675990 187676105 Mouse 12904944 Tammq1_m tibialis anterior muscle mass QTL 1 (mouse) 1 155002940 189002940 Mouse 1357485 Lgq4_m late growth QTL 4 (mouse) Not determined 1 150193673 188359312 Mouse 12904957 Gmmq1_m gastrocnemius muscle mass QTL 1 (mouse) 1 155002940 189002940 Mouse 11532690 Sluc37_m susceptibility to lung cancer 37 (mouse) 1 175468817 194111528 Mouse 1301932 Ssta2_m susceptibility to Salmonella typhimurium antigens 2 (mouse) Not determined 1 155716221 189716369 Mouse 1301202 Yaa4_m Y-linked autoimmune acceleration 4 (mouse) Not determined 1 158468817 192468938 Mouse 10054490 Opefa_m open field activity (mouse) Not determined 1 153712853 187712853 Mouse 1300823 Ath9_m atherosclerosis 9 (mouse) Not determined 1 160112768 194112883 Mouse 1301333 Mop3_m morphine preference 3 (mouse) Not determined 1 167756737 189303617 Mouse 1300948 Fglu2_m fasting glucose 2 (mouse) Not determined 1 157456299 191456436 Mouse 1301339 Hdlq15_m HDL QTL 15 (mouse) Not determined 1 165873675 195154279 Mouse 1301722 Cia9_m collagen induced arthritis QTL 9 (mouse) Not determined 1 45783900 189303617 Mouse 11059556 Lmr20b_m leishmaniasis resistance 20b (mouse) 1 158468817 192468938 Mouse 4141554 Cfmq1_m cystic fibrosis modifier QTL 1 (mouse) Not determined 1 152038741 186038913 Mouse 11059557 Lmr20a_m leishmaniasis resistance 20a (mouse) 1 158468817 192468938 Mouse 11059558 Lmr20c_m leishmaniasis resistance 20c (mouse) 1 158468817 192468938 Mouse 10043863 Swrl5_m SWR lupus locus 5 (mouse) Not determined 1 172303451 195154279 Mouse 1301596 Elnt_m escape latencies during navigation task (mouse) Not determined 1 162145207 194111528 Mouse 11049575 Lmr8b_m leishmaniasis resistance 8b (mouse) 1 172303451 195154279 Mouse 4141165 Bglu3_m blood glucose level 3 (mouse) Not determined 155831765 189831892 Mouse 12792983 Liq1_m limb inflammation QTL 1 (mouse) 1 167586086 191225397 Mouse 1357889 Lprq3_m lipoprotein QTL 3 (mouse) Not determined 1 152038741 186038913 Mouse 1301189 Lmr8_m leishmaniasis resistance 8 (mouse) Not determined 1 156602037 189303617 Mouse 4142182 Shali5_m survival time to hyperoxic acute lung injury 5 (mouse) Not determined 155582237 185994196 Mouse 10766456 Sle21_m systematic lupus erythematosus susceptibility 21 (mouse) 1 155831765 189831892 Mouse 10402498 Lmr20_m leishmaniasis resistance 20 (mouse) Not determined 1 158468817 192468938 Mouse 1301619 Cafq1_m caffeine metabolism QTL 1 (mouse) Not determined 1 155716221 189716369 Mouse 4141149 Hbnr4_m Heligmosomoides bakeri nematode resistance 4 (mouse) Not determined 147125258 188983224 Mouse 1300727 Mptp1_m MPTP sensitivity 1 (mouse) Not determined 1 171632048 192681050 Mouse 10054271 Nba9_m New Zealand Black autoimmunity 9 (mouse) Not determined 1 155525623 189527533 Mouse 11081167 Tir8_m trypanosome infection response 8 (mouse) 1 155716221 189716369 Mouse 10054270 Nba10_m New Zealand Black autoimmunity 10 (mouse) Not determined 1 152794822 186438620 Mouse 1302132 Pbw1_m pentobarbital withdrawal QTL 1 (mouse) Not determined 1 155831765 189831892 Mouse 1559024 Zit1_m zinc induced tolerance 1 (mouse) Not determined 1 167462514 195154279 Mouse 1357692 Axtq1_m anxiety QTL 1 (mouse) Not determined 1 180832317 191851043 Mouse 12880429 V25Dq1_m vitamin D inactive form serum level QTL 1 (mouse) 1 172632197 195154279 Mouse 12880426 V25Dq2_m vitamin D inactive form serum level QTL 2 (mouse) 1 172532197 195154279 Mouse 1300732 Melm2_m melanoma modifier 2 (mouse) Not determined 1 157456299 191456436 Mouse 4142159 Nba2_m New Zealand Black autoimmunity 2 (mouse) Not determined 151835111 185835280 Mouse 1301602 Bslm4_m basal locomotor activity 4 (mouse) Not determined 1 157456299 191456436 Mouse 1301216 Cbm1_m cerebellum weight 1 (mouse) Not determined 1 157456299 191456436 Mouse 1301866 Cplaq3_m circadian period of locomotor activity 3 (mouse) Not determined 1 155721528 189722608 Mouse 1300842 Sle9_m systematic lupus erythematosus susceptibility 9 (mouse) Not determined 1 158468817 192468938 Mouse 1300969 Sluc5_m susceptibility to lung cancer 5 (mouse) Not determined 1 151186243 185186402 Mouse 1301614 Cgnz1_m chronic glomerulonephritis in NZM 1 (mouse) Not determined 1 152038741 186038913 Mouse
AW491150
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 1 184,896,795 - 184,896,902 UniSTS GRCm38 MGSCv37 1 186,720,674 - 186,720,781 UniSTS GRCm37 Celera 1 191,860,613 - 191,860,720 UniSTS Cytogenetic Map 1 H5 UniSTS Whitehead/MRC_RH 1 2301.33 UniSTS
D1Mit152
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 1 184,939,026 - 184,939,118 UniSTS GRCm38 MGSCv37 1 186,762,905 - 186,762,997 UniSTS GRCm37 Celera 1 191,902,975 - 191,903,067 UniSTS Cytogenetic Map 1 H5 UniSTS cM Map 1 101.5 UniSTS Whitehead Genetic 1 103.8 UniSTS Whitehead/MRC_RH 1 2303.91 UniSTS
BB357210
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 1 184,898,416 - 184,898,498 UniSTS GRCm38 MGSCv37 1 186,722,295 - 186,722,377 UniSTS GRCm37 Celera 1 191,862,234 - 191,862,316 UniSTS Cytogenetic Map 1 H5 UniSTS Whitehead/MRC_RH 1 2309.25 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000027929 ⟹ ENSMUSP00000027929
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 1 184,628,986 - 184,731,767 (-) Ensembl GRCm38.p6 Ensembl 1 184,896,789 - 184,999,570 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000192657 ⟹ ENSMUSP00000142314
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 1 184,651,714 - 184,731,672 (-) Ensembl GRCm38.p6 Ensembl 1 184,919,517 - 184,999,475 (-) Ensembl
RefSeq Acc Id:
NM_001378876 ⟹ NP_001365805
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 184,628,986 - 184,732,151 (-) NCBI GRCm38 1 184,896,789 - 184,999,954 (-) NCBI
Sequence:
ACCCGGCGGCGGCCGCCAAGAGCCTCGGGGCGCTGCGTGCCGTGCCGCGCCCGCCGCTCCGCGCGCACCGGCTCCGGCCGCCGAGGGCTCCGGCTGATCGCGGCGGGGACGGCGCGGAGCGGCGCGCG
hide sequence
RefSeq Acc Id:
NM_145515 ⟹ NP_663490
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 184,628,621 - 184,731,746 (-) NCBI GRCm38 1 184,896,424 - 184,999,549 (-) NCBI MGSCv37 1 186,720,303 - 186,823,428 (-) RGD Celera 1 191,860,242 - 191,963,269 (-) RGD cM Map 1 ENTREZGENE
Sequence:
GCGCGCCCGCCCTCGCCGAAGCCCTCCGCGGCCCGCGACCCGCCGGACCCCCCGCTCGACCCCGCTGCCCGCGCAAGATGTCGGCGCGGACGCCATTGCCCACGGTGAACGAGCGGGACACGGAGAAC
hide sequence
RefSeq Acc Id:
XM_006497140 ⟹ XP_006497203
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 184,628,986 - 184,732,152 (-) NCBI GRCm38 1 184,896,789 - 184,999,901 (-) NCBI
Sequence:
CACCCGGCGGCGGCCGCCAAGAGCCTCGGGGCGCTGCGTGCCGTGCCGCGCCCGCCGCTCCGCGCGCACCGGCTCCGGCCGCCGAGGGCTCCGGCTGATCGCGGCGGGGACGGCGCGGAGCGGCGCGC
hide sequence
RefSeq Acc Id:
XM_006497141 ⟹ XP_006497204
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 184,630,280 - 184,732,152 (-) NCBI GRCm38 1 184,896,789 - 184,999,901 (-) NCBI
Sequence:
CACCCGGCGGCGGCCGCCAAGAGCCTCGGGGCGCTGCGTGCCGTGCCGCGCCCGCCGCTCCGCGCGCACCGGCTCCGGCCGCCGAGGGCTCCGGCTGATCGCGGCGGGGACGGCGCGGAGCGGCGCGC
hide sequence
RefSeq Acc Id:
XM_030253538 ⟹ XP_030109398
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 184,628,986 - 184,675,456 (-) NCBI GRCm38 1 184,896,789 - 184,943,259 (-) NCBI
Sequence:
GTCGCTGTGAAAATAATAGACAAAACTCAGCTAAACCCTACCAGTCTACAGAAGTTGTTCCGAGAAGTACGAATAATGAAGATACTGAACCATCCTAACATAGTGAAACTGTTTGAAGTTATTGAAAC
hide sequence
RefSeq Acc Id:
NP_663490 ⟸ NM_145515
- Peptide Label:
isoform 2
- UniProtKB:
E9QL17 (UniProtKB/Swiss-Prot), Q69ZI7 (UniProtKB/Swiss-Prot), Q8VHJ5 (UniProtKB/Swiss-Prot), Q14DQ3 (UniProtKB/TrEMBL)
- Sequence:
MSARTPLPTVNERDTENHTSVDGYTETHIPPAKSSSRQNLPRCRNSITSATDEQPHIGNYRLQKTIGKGNFAKVKLARHVLTGREVAVKIIDKTQLNPTSLQKLFREVRIMKILNHPNIVKLFEVIET
hide sequence
RefSeq Acc Id:
XP_006497204 ⟸ XM_006497141
- Peptide Label:
isoform X2
- UniProtKB:
Q14DQ3 (UniProtKB/TrEMBL)
- Sequence:
MSARTPLPTVNERDTENHTSVDGYTETHIPPAKSSSRQNLPRCRNSITSATDEQPHIGNYRLQK
hide sequence
RefSeq Acc Id:
XP_006497203 ⟸ XM_006497140
- Peptide Label:
isoform X1
- UniProtKB:
C9K101 (UniProtKB/TrEMBL)
- Sequence:
MSARTPLPTVNERDTENHTSVDGYTETHIPPAKSSSRQNLPRCRNSITSATDEQPHIGNYRLQKTIGKGNFAKVKLARHVLTGREVAVKIIDKTQLNPTSLQKLFREVRIMKILNHPNIVKLFEVIET
hide sequence
RefSeq Acc Id:
XP_030109398 ⟸ XM_030253538
- Peptide Label:
isoform X3
RefSeq Acc Id:
NP_001365805 ⟸ NM_001378876
- Peptide Label:
isoform 1
- UniProtKB:
C9K101 (UniProtKB/TrEMBL)
Ensembl Acc Id:
ENSMUSP00000027929 ⟸ ENSMUST00000027929
Ensembl Acc Id:
ENSMUSP00000142314 ⟸ ENSMUST00000192657
RGD ID: 6876018 Promoter ID: EPDNEW_M1460 Type: multiple initiation site Name: Mark1_1 Description: Mus musculus MAP/microtubule affinity regulating kinase 1 , mRNA. SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Mouse Assembly Chr Position (strand) Source GRCm38 1 184,999,572 - 184,999,632 EPDNEW
RGD ID: 6818059 Promoter ID: MM_KWN:3211 Type: CpG-Island SO ACC ID: SO:0000170 Source: MPROMDB Tissues & Cell Lines: Brain, Lung Transcripts: NM_145515 Position: Mouse Assembly Chr Position (strand) Source MGSCv36 1 186,824,054 - 186,824,554 (-) MPROMDB
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2015-05-26
Mark1
MAP/microtubule affinity regulating kinase 1
MAP/microtubule affinity-regulating kinase 1
Symbol and/or name change
5135510 APPROVED
