Symbol: |
Mir3581 (Ensembl: Mir409) |
Name: |
microRNA 3581 (Ensembl:microRNA 409) |
RGD ID: |
4888593 |
Description: |
Orthologous to human MIR656 (microRNA 656); INTERACTS WITH bisphenol A; cadmium dichloride; 17beta-estradiol (ortholog). |
Type: |
ncrna (Ensembl: miRNA)
|
RefSeq Status: |
PROVISIONAL |
Previously known as: |
microRNA mir-3581; Mir409b; rno-mir-3581; rno-mir-409b |
RGD Orthologs |
|
Alliance Orthologs |
|
More Info |
more info ...
|
More Info |
|
Latest Assembly: |
GRCr8 - GRCr8 Assembly |
Position: |
Rat Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCr8 | 6 | 134,579,184 - 134,579,263 (-) | NCBI | | GRCr8 | | | mRatBN7.2 | 6 | 128,757,779 - 128,757,858 (-) | NCBI | mRatBN7.2 | mRatBN7.2 | | | mRatBN7.2 Ensembl | 6 | 128,757,779 - 128,757,858 (-) | Ensembl | | mRatBN7.2 Ensembl | | | UTH_Rnor_SHR_Utx | 6 | 128,937,018 - 128,937,097 (-) | NCBI | Rnor_SHR | UTH_Rnor_SHR_Utx | | | UTH_Rnor_SHRSP_BbbUtx_1.0 | 6 | 129,232,850 - 129,232,929 (-) | NCBI | Rnor_SHRSP | UTH_Rnor_SHRSP_BbbUtx_1.0 | | | UTH_Rnor_WKY_Bbb_1.0 | 6 | 128,594,475 - 128,594,554 (-) | NCBI | Rnor_WKY | UTH_Rnor_WKY_Bbb_1.0 | | | Rnor_6.0 | 6 | 133,893,418 - 133,893,497 (-) | NCBI | Rnor6.0 | Rnor_6.0 | rn6 | Rnor6.0 | Rnor_6.0 Ensembl | 6 | 133,893,418 - 133,893,497 (-) | Ensembl | Rnor6.0 | | rn6 | Rnor6.0 | Rnor_5.0 | 6 | 143,055,775 - 143,055,854 (-) | NCBI | Rnor5.0 | Rnor_5.0 | rn5 | Rnor5.0 | Celera | 6 | 126,342,158 - 126,342,237 (-) | NCBI | | Celera | | | Cytogenetic Map | 6 | q32 | NCBI | | | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
Mir3581 (Rattus norvegicus - Norway rat) |
Rat Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCr8 | 6 | 134,579,184 - 134,579,263 (-) | NCBI | | GRCr8 | | | mRatBN7.2 | 6 | 128,757,779 - 128,757,858 (-) | NCBI | mRatBN7.2 | mRatBN7.2 | | | mRatBN7.2 Ensembl | 6 | 128,757,779 - 128,757,858 (-) | Ensembl | | mRatBN7.2 Ensembl | | | UTH_Rnor_SHR_Utx | 6 | 128,937,018 - 128,937,097 (-) | NCBI | Rnor_SHR | UTH_Rnor_SHR_Utx | | | UTH_Rnor_SHRSP_BbbUtx_1.0 | 6 | 129,232,850 - 129,232,929 (-) | NCBI | Rnor_SHRSP | UTH_Rnor_SHRSP_BbbUtx_1.0 | | | UTH_Rnor_WKY_Bbb_1.0 | 6 | 128,594,475 - 128,594,554 (-) | NCBI | Rnor_WKY | UTH_Rnor_WKY_Bbb_1.0 | | | Rnor_6.0 | 6 | 133,893,418 - 133,893,497 (-) | NCBI | Rnor6.0 | Rnor_6.0 | rn6 | Rnor6.0 | Rnor_6.0 Ensembl | 6 | 133,893,418 - 133,893,497 (-) | Ensembl | Rnor6.0 | | rn6 | Rnor6.0 | Rnor_5.0 | 6 | 143,055,775 - 143,055,854 (-) | NCBI | Rnor5.0 | Rnor_5.0 | rn5 | Rnor5.0 | Celera | 6 | 126,342,158 - 126,342,237 (-) | NCBI | | Celera | | | Cytogenetic Map | 6 | q32 | NCBI | | | | |
|
MIR656 (Homo sapiens - human) |
Human Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCh38 | 14 | 101,066,724 - 101,066,801 (+) | NCBI | GRCh38 | GRCh38 | hg38 | GRCh38 | GRCh38.p14 Ensembl | 14 | 101,066,724 - 101,066,801 (+) | Ensembl | GRCh38 | | hg38 | GRCh38 | GRCh37 | 14 | 101,533,061 - 101,533,138 (+) | NCBI | GRCh37 | GRCh37 | hg19 | GRCh37 | Build 36 | 14 | 100,602,813 - 100,602,890 (+) | NCBI | NCBI36 | Build 36 | hg18 | NCBI36 | Celera | 14 | 81,589,123 - 81,589,200 (+) | NCBI | | Celera | | | Cytogenetic Map | 14 | q32.31 | NCBI | | | | | HuRef | 14 | 81,716,435 - 81,716,512 (+) | NCBI | | HuRef | | | CHM1_1 | 14 | 101,472,083 - 101,472,160 (+) | NCBI | | CHM1_1 | | | T2T-CHM13v2.0 | 14 | 95,302,111 - 95,302,188 (+) | NCBI | | T2T-CHM13v2.0 | | |
|
.
Predicted Targets
Count of predictions: | 19988 | Count of gene targets: | 9786 | Count of transcripts: | 10624 | Interacting mature miRNAs: | rno-miR-409b | Prediction methods: | Microtar, Miranda, Pita, Rnahybrid, Targetscan | Result types: | miRGate_prediction |
12801411 | Schws8 | Schwannoma susceptibility QTL 8 | | | nervous system integrity trait (VT:0010566) | percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017) | 6 | 94968928 | 139968928 | Rat | 1331799 | Bp211 | Blood pressure QTL 211 | 3.66407 | | arterial blood pressure trait (VT:2000000) | mean arterial blood pressure (CMO:0000009) | 6 | 72202632 | 130919985 | Rat | 71111 | Iddm8 | Insulin dependent diabetes mellitus QTL 8 | 1.9 | 0.002 | blood glucose amount (VT:0000188) | plasma glucose level (CMO:0000042) | 6 | 105156861 | 140994061 | Rat | 1358355 | Srcrt4 | Stress Responsive Cort QTL 4 | 6.39 | | blood corticosterone amount (VT:0005345) | plasma corticosterone level (CMO:0001173) | 6 | 100364669 | 140994061 | Rat | 61329 | Eae9 | Experimental allergic encephalomyelitis QTL 9 | 3.7 | | body mass (VT:0001259) | change in body weight (CMO:0002045) | 6 | 122549046 | 140994061 | Rat | 2312560 | Pur20 | Proteinuria QTL 20 | 2.1 | 0.005 | urine total protein amount (VT:0000032) | urine total protein excretion rate (CMO:0000756) | 6 | 125628133 | 137801795 | Rat | 2313399 | Anxrr28 | Anxiety related response QTL 28 | | | aggression-related behavior trait (VT:0015014) | tameness/aggressiveness composite score (CMO:0002136) | 6 | 100671796 | 132340886 | Rat | 8552796 | Vie3 | Viral induced encephalitis QTL 3 | 2.6 | | brain integrity trait (VT:0010579) | encephalitis incidence/prevalence measurement (CMO:0002361) | 6 | 96833997 | 140994061 | Rat | 4145118 | Mcs26 | Mammary carcinoma susceptibility QTL 26 | | 0.0001 | mammary gland integrity trait (VT:0010552) | post-insult time to mammary tumor formation (CMO:0000345) | 6 | 106752656 | 132339866 | Rat | 1581563 | Uae33 | Urinary albumin excretion QTL 33 | | | urine albumin amount (VT:0002871) | urine albumin excretion rate (CMO:0000757) | 6 | 72227641 | 130729205 | Rat | 10054138 | Gmadr3 | Adrenal mass QTL 3 | 3.68 | 0.00045 | adrenal gland mass (VT:0010420) | both adrenal glands wet weight (CMO:0000164) | 6 | 85140138 | 130140138 | Rat | 1641917 | Colcr5 | Colorectal carcinoma resistance QTL 5 | 3.18 | 0.0009 | intestine integrity trait (VT:0010554) | benign colorectal tumor number (CMO:0001795) | 6 | 122549046 | 137801795 | Rat | 61414 | Pia3 | Pristane induced arthritis QTL 3 | 4.5 | | joint integrity trait (VT:0010548) | post-insult time to onset of experimental arthritis (CMO:0001450) | 6 | 94968928 | 137848904 | Rat | 724513 | Uae14 | Urinary albumin excretion QTL 14 | 6.5 | | urine albumin amount (VT:0002871) | urine albumin excretion rate (CMO:0000757) | 6 | 85311061 | 133478515 | Rat | 2303624 | Vencon5 | Ventilatory control QTL 5 | 4.45 | | respiration trait (VT:0001943) | minute ventilation (CMO:0000132) | 6 | 88047916 | 133047916 | Rat | 731173 | Uae22 | Urinary albumin excretion QTL 22 | 10.1 | | urine albumin amount (VT:0002871) | urine albumin excretion rate (CMO:0000757) | 6 | 65531555 | 140994061 | Rat | 10054123 | Srcrt6 | Stress Responsive Cort QTL 6 | 2.5 | 0.0043 | blood corticosterone amount (VT:0005345) | plasma corticosterone level (CMO:0001173) | 6 | 85140138 | 130140138 | Rat | 724536 | Uae7 | Urinary albumin excretion QTL 7 | 3.5 | | urine albumin amount (VT:0002871) | urine albumin level (CMO:0000130) | 6 | 72202632 | 130729475 | Rat | 737976 | Pia24 | Pristane induced arthritis QTL 24 | | | joint integrity trait (VT:0010548) | joint inflammation composite score (CMO:0000919) | 6 | 112636280 | 140994061 | Rat | 1298087 | Iddm18 | Insulin dependent diabetes mellitus QTL 18 | | 0.0001 | urine glucose amount (VT:0001758) | percentage of study population developing diabetes mellitus during a period of time (CMO:0001114) | 6 | 116506292 | 130245370 | Rat | 1581550 | Pur8 | Proteinuria QTL 8 | | | urine total protein amount (VT:0000032) | urine total protein excretion rate (CMO:0000756) | 6 | 72227641 | 130729205 | Rat | 738034 | Anxrr5 | Anxiety related response QTL 5 | 5.9 | | exploratory behavior trait (VT:0010471) | percentage of entries into a discrete space in an experimental apparatus (CMO:0000961) | 6 | 84130881 | 129130881 | Rat | 2290393 | Uae37 | Urinary albumin excretion QTL 37 | | 0.0001 | urine albumin amount (VT:0002871) | urine albumin excretion rate (CMO:0000757) | 6 | 65531555 | 140994061 | Rat | 1300076 | Glom8 | Glomerulus QTL 8 | 7 | 9e-09 | kidney glomerulus morphology trait (VT:0005325) | count of superficial glomeruli directly contacting the kidney surface (CMO:0001001) | 6 | 86894788 | 131894788 | Rat | 2293085 | Iddm29 | Insulin dependent diabetes mellitus QTL 29 | 7.66 | | blood glucose amount (VT:0000188) | blood glucose level (CMO:0000046) | 6 | 122549046 | 140286318 | Rat |
Ensembl Acc Id: |
ENSRNOT00000053696 |
Type: |
CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
mRatBN7.2 Ensembl | 6 | 128,757,779 - 128,757,858 (-) | Ensembl | Rnor_6.0 Ensembl | 6 | 133,893,418 - 133,893,497 (-) | Ensembl |
|
RefSeq Acc Id: |
NR_037374 |
RefSeq Status: |
PROVISIONAL |
Type: |
NON-CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
GRCr8 | 6 | 134,579,184 - 134,579,263 (-) | NCBI | mRatBN7.2 | 6 | 128,757,779 - 128,757,858 (-) | NCBI | Rnor_6.0 | 6 | 133,893,418 - 133,893,497 (-) | NCBI | Rnor_5.0 | 6 | 143,055,775 - 143,055,854 (-) | NCBI | Celera | 6 | 126,342,158 - 126,342,237 (-) | NCBI |
|
Sequence: |
TTGATACCGAAAAGGGGTTCACCGAGCAACATTCGTCCTCCAGATGCAAAGTTGCTCGGGTAACCTCTCTCCGAGTACCA
hide sequence
|
Date |
Current Symbol |
Current Name |
Previous Symbol |
Previous Name |
Description |
Reference |
Status |
2014-10-27 |
Mir3581 |
microRNA 3581 |
Mir3581 |
microRNA mir-3581 |
Nomenclature updated to reflect human and mouse nomenclature |
1299863 |
APPROVED |
2010-11-23 |
Mir3581 |
microRNA mir-3581 |
|
|
Symbol and Name status set to provisional |
70820 |
PROVISIONAL |
|
|