Symbol:
Mir3550
Name:
microRNA 3550
RGD ID:
4888555
Description:
microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq]
Type:
ncrna (Ensembl: miRNA)
RefSeq Status:
PROVISIONAL
Previously known as:
rno-mir-3550
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 19 40,133,492 - 40,133,605 (+) NCBI GRCr8 mRatBN7.2 19 23,228,641 - 23,228,754 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 19 23,228,641 - 23,228,754 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 19 30,051,590 - 30,051,703 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 19 30,705,954 - 30,706,067 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 19 32,928,636 - 32,928,749 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 19 26,041,428 - 26,041,541 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 19 26,041,428 - 26,041,541 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 19 37,017,051 - 37,017,164 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 Celera 19 22,785,611 - 22,785,724 (+) NCBI Celera Cytogenetic Map 19 q11 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
.
Predicted Targets
Count of predictions: 3279 Count of gene targets: 2874 Count of transcripts: 3090 Interacting mature miRNAs: rno-miR-3550 Prediction methods: Microtar, Miranda, Pita, Rnahybrid, Targetscan Result types: miRGate_prediction
1549847 Bss8 Bone structure and strength QTL 8 4 lumbar vertebra strength trait (VT:0010574) vertebra ultimate force (CMO:0001678) 19 1 31963836 Rat 61447 Tcas1 Tongue tumor susceptibility QTL 1 6.08 tongue integrity trait (VT:0010553) squamous cell carcinoma of the tongue maximum tumor diameter (CMO:0001875) 19 2316121 47316121 Rat 631681 Cm12 Cardiac mass QTL 12 3.33 0.00053 heart left ventricle mass (VT:0007031) heart left ventricle weight to body weight ratio (CMO:0000530) 19 1 28982497 Rat 9590298 Uminl5 Urine mineral level QTL 5 3.59 0.001 urine mineral amount (VT:0015086) urine electrolyte level (CMO:0000593) 19 1 36824771 Rat 1331737 Uae29 Urinary albumin excretion QTL 29 5.5 urine albumin amount (VT:0002871) urine albumin level (CMO:0000130) 19 4096155 55283277 Rat 2298478 Eau8 Experimental allergic uveoretinitis QTL 8 0.0163 uvea integrity trait (VT:0010551) experimental autoimmune uveitis score (CMO:0001504) 19 17154433 57337602 Rat 1578764 Stresp19 Stress response QTL 19 3.6 0.001 blood renin amount (VT:0003349) plasma renin activity level (CMO:0000116) 19 15630201 57337602 Rat 1558656 Prcs1 Prostate cancer susceptibility QTL 1 5 prostate integrity trait (VT:0010571) percentage of study population developing ventral prostate tumorous lesions during a period of time (CMO:0000943) 19 15114598 34521833 Rat 9590090 Insglur8 Insulin/glucose ratio QTL 8 10.81 0.001 blood insulin amount (VT:0001560) calculated plasma insulin level (CMO:0002170) 19 1 36824771 Rat 1331788 Rf45 Renal function QTL 45 2.818 kidney blood vessel physiology trait (VT:0100012) absolute change in renal blood flow rate (CMO:0001168) 19 15605023 46559041 Rat 724566 Uae12 Urinary albumin excretion QTL 12 5 urine albumin amount (VT:0002871) urine albumin level (CMO:0000130) 19 2187927 56457239 Rat 724565 Tcas5 Tongue tumor susceptibility QTL 5 10.04 tongue integrity trait (VT:0010553) number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950) 19 9977753 39654489 Rat 61407 Scl12 Serum cholesterol level QTL 12 0.001 blood HDL cholesterol amount (VT:0000184) serum high density lipoprotein cholesterol level (CMO:0000361) 19 13926401 30303727 Rat 8552935 Pigfal10 Plasma insulin-like growth factor 1 level QTL 10 5.7 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 19 1 36824771 Rat 61350 Bp32 Blood pressure QTL 32 0.012 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 19 20483575 57337602 Rat 7411549 Bw130 Body weight QTL 130 5 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 19 15455860 57337602 Rat 10054132 Srcrt9 Stress Responsive Cort QTL 9 2.87 0.0017 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 19 1 27355345 Rat 724518 Uae19 Urinary albumin excretion QTL 19 5.5 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 19 7457249 42983518 Rat 8694186 Bw152 Body weight QTL 152 3.34 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 19 569374 45569374 Rat 61423 Cia14 Collagen induced arthritis QTL 14 3 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 19 10827970 43544039 Rat 7411590 Foco7 Food consumption QTL 7 6.8 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 19 1 24688055 Rat 631678 Cm9 Cardiac mass QTL 9 4.27 0.0001 aorta mass (VT:0002845) aorta weight (CMO:0000076) 19 1 28982497 Rat 9590250 Scort11 Serum corticosterone level QTL 11 23.45 0.001 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 19 1 36824771 Rat 2317848 Alcrsp21 Alcohol response QTL 21 1.899999976158142 0.05 response to alcohol trait (VT:0010489) duration of loss of righting reflex (CMO:0002289) 19 3204777 48204777 Rat 9589102 Slep13 Serum leptin concentration QTL 13 4.63 0.001 blood leptin amount (VT:0005667) plasma leptin level (CMO:0000781) 19 569374 45569374 Rat 7247442 Uae39 Urinary albumin excretion QTL 39 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 19 2187927 46708701 Rat
AU047778
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 19 23,227,902 - 23,228,134 (-) MAPPER mRatBN7.2 Rnor_6.0 19 26,042,048 - 26,042,279 NCBI Rnor6.0 Rnor_5.0 19 37,017,671 - 37,017,902 UniSTS Rnor5.0 RGSC_v3.4 19 24,884,192 - 24,884,423 UniSTS RGSC3.4 Cytogenetic Map 19 q11 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSRNOT00000075470
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 19 23,228,641 - 23,228,754 (+) Ensembl Rnor_6.0 Ensembl 19 26,041,428 - 26,041,541 (-) Ensembl
RefSeq Acc Id:
NR_037326
RefSeq Status:
PROVISIONAL
Type:
NON-CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 19 40,133,492 - 40,133,605 (+) NCBI mRatBN7.2 19 23,228,641 - 23,228,754 (+) NCBI Rnor_6.0 19 26,041,428 - 26,041,541 (-) NCBI Rnor_5.0 19 37,017,051 - 37,017,164 (-) NCBI Celera 19 22,785,611 - 22,785,724 (+) NCBI
Sequence:
CTTCTGGAGTGCCTGGTGAGGGGTGGTTTGAGCAGTGTGGGGCATGGGGTGGCCCTCACTGGGCACACCAACCAAGCCGAGCCCATCCCTGCCCTAGGAATTCAACCCAGAAGA
hide sequence
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2015-04-09
Mir3550
microRNA 3550
Mir3550
microRNA mir-3550
Name updated
61478 APPROVED
2010-11-23
Mir3550
microRNA mir-3550
Symbol and Name status set to provisional
70820 PROVISIONAL
