Symbol:
Mir499a
Name:
microRNA 499a
RGD ID:
2325514
Description:
Predicted to enable mRNA 3'-UTR binding activity and mRNA base-pairing translational repressor activity. Predicted to be involved in several processes, including miRNA-mediated gene silencing by inhibition of translation; positive regulation of cell migration; and positive regulation of cell population proliferation. Predicted to act upstream of or within cellular response to decreased oxygen levels; muscle cell development; and regulation of gene expression. Orthologous to human MIR499A (microRNA 499a); INTERACTS WITH aflatoxin B1; bisphenol A; cadmium atom.
Type:
ncrna (Ensembl: miRNA)
RefSeq Status:
PROVISIONAL
Previously known as:
microRNA 499; Mir499; rno-mir-499
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 3 164,570,612 - 164,570,676 (+) NCBI GRCr8 mRatBN7.2 3 144,110,469 - 144,110,533 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 3 144,110,469 - 144,110,533 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 3 147,976,772 - 147,976,836 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 3 156,594,052 - 156,594,116 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 3 154,333,590 - 154,333,654 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 3 151,138,862 - 151,138,926 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 3 151,138,862 - 151,138,926 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 3 157,506,669 - 157,506,733 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 Celera 3 142,834,661 - 142,834,725 (+) NCBI Celera Cytogenetic Map 3 q42 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Mir499a Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 3 164,570,612 - 164,570,676 (+) NCBI GRCr8 mRatBN7.2 3 144,110,469 - 144,110,533 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 3 144,110,469 - 144,110,533 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 3 147,976,772 - 147,976,836 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 3 156,594,052 - 156,594,116 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 3 154,333,590 - 154,333,654 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 3 151,138,862 - 151,138,926 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 3 151,138,862 - 151,138,926 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 3 157,506,669 - 157,506,733 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 Celera 3 142,834,661 - 142,834,725 (+) NCBI Celera Cytogenetic Map 3 q42 NCBI
MIR499A Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 20 34,990,376 - 34,990,497 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 20 34,990,376 - 34,990,497 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 20 33,578,179 - 33,578,300 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 20 33,041,839 - 33,041,960 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Celera 20 30,327,269 - 30,327,390 (+) NCBI Celera Cytogenetic Map 20 q11.22 NCBI HuRef 20 30,356,542 - 30,356,663 (+) NCBI HuRef CHM1_1 20 33,479,374 - 33,479,495 (+) NCBI CHM1_1 T2T-CHM13v2.0 20 36,711,016 - 36,711,137 (+) NCBI T2T-CHM13v2.0
Mir499 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 2 155,464,800 - 155,464,878 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 2 155,464,800 - 155,464,878 (+) Ensembl GRCm39 Ensembl GRCm38 2 155,622,880 - 155,622,958 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 2 155,622,880 - 155,622,958 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 2 155,448,616 - 155,448,694 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 Celera 2 161,555,145 - 161,555,223 (+) NCBI Celera Cytogenetic Map 2 H1 NCBI cM Map 2 77.26 NCBI
.
Confirmed Targets
Ppp3ca rno-miR-499-5p Mirtarbase external_info Luciferase reporter assay//qRT-PCR//Western blot Functional MTI 21186368
Predicted Targets
Count of predictions: 5718 Count of gene targets: 3829 Count of transcripts: 4119 Interacting mature miRNAs: rno-miR-499-3p, rno-miR-499-5p Prediction methods: Microtar, Miranda, Pita, Rnahybrid, Targetscan Result types: miRGate_prediction
2312673 Scl63 Serum cholesterol level QTL 63 0.001 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 3 98535255 168026850 Rat 1598877 Bp285 Blood pressure QTL 285 1.5 0.03 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 3 120538241 165538241 Rat 1578653 Vnigr3 Vascular neointimal growth QTL 3 3.1 artery morphology trait (VT:0002191) artery neointimal hyperplastic lesion area (CMO:0001414) 3 130656562 169034231 Rat 2302373 Gluco39 Glucose level QTL 39 5.01 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 3 98535386 161695835 Rat 1298068 Bp167 Blood pressure QTL 167 0.004 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 3 141074471 169034231 Rat 70216 Cm14 Cardiac mass QTL 14 2.1 heart mass (VT:0007028) heart wet weight (CMO:0000069) 3 31172320 163586636 Rat 2292591 Esta4 Estrogen-induced thymic atrophy QTL 4 thymus mass (VT:0004954) thymus wet weight (CMO:0000855) 3 47233211 147415807 Rat 2298477 Eau4 Experimental allergic uveoretinitis QTL 4 0.0011 uvea integrity trait (VT:0010551) experimental autoimmune uveitis score (CMO:0001504) 3 137398739 169034231 Rat 61335 Bp20 Blood pressure QTL 20 3 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 3 141339236 155617360 Rat 1581568 Rf53 Renal function QTL 53 urine total protein amount (VT:0000032) urine protein excretion rate to body weight ratio (CMO:0001099) 3 56395968 161299569 Rat 1578754 Stresp16 Stress response QTL 16 4 0.001 blood renin amount (VT:0003349) plasma renin activity level (CMO:0000116) 3 112681431 157681431 Rat 1331726 Bp208 Blood pressure QTL 208 3.129 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 3 141339013 162184794 Rat 1300173 Rf11 Renal function QTL 11 3.38 renal blood flow trait (VT:2000006) absolute change in renal blood flow rate (CMO:0001168) 3 121056165 145956249 Rat 9589106 Insul23 Insulin level QTL 23 13.86 0.001 blood insulin amount (VT:0001560) plasma insulin level (CMO:0000342) 3 131635904 169034231 Rat 10755461 Coatc16 Coat color QTL 16 coat/hair pigmentation trait (VT:0010463) pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812) 3 122438700 167438700 Rat 8662816 Vetf4 Vascular elastic tissue fragility QTL 4 4 renal artery integrity trait (VT:0010642) number of ruptures of the internal elastic lamina of the renal arteries (CMO:0002563) 3 59242096 157323038 Rat 1559282 Emca5 Estrogen-induced mammary cancer QTL 5 3.9 mammary gland integrity trait (VT:0010552) percentage of study population developing mammary tumors during a period of time (CMO:0000948) 3 43827364 169034231 Rat 2303620 Vencon4 Ventilatory control QTL 4 3.9 respiration trait (VT:0001943) tidal volume (CMO:0000222) 3 127162703 168026850 Rat 631841 Niddm39 Non-insulin dependent diabetes mellitus QTL 39 3.36 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 3 94856903 159898684 Rat 1576306 Schws3 Schwannoma susceptibility QTL 3 0.001 nervous system integrity trait (VT:0010566) percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017) 3 118839124 163839124 Rat 619618 Rf3 Renal disease susceptibility QTL 3 6.5 0.001 urine albumin amount (VT:0002871) urine albumin excretion rate to body weight ratio (CMO:0001270) 3 107693393 152693393 Rat 1300159 Kidm4 Kidney mass QTL 4 3.83 kidney mass (VT:0002707) right kidney wet weight to body weight ratio (CMO:0001953) 3 121056165 157309487 Rat 5686842 Rf59 Renal function QTL 59 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 3 140069424 146976080 Rat 2301971 Cm71 Cardiac mass QTL 71 4.63 heart left ventricle mass (VT:0007031) heart left ventricle weight (CMO:0000776) 3 41874578 155617519 Rat 2312659 Slep7 Serum leptin concentration QTL 7 0.001 blood leptin amount (VT:0005667) serum leptin level (CMO:0000780) 3 98535255 168026850 Rat 631673 Iddm13 Insulin dependent diabetes mellitus QTL 13 1.3 0.663 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 3 130193298 161695983 Rat 2301970 Bw81 Body weight QTL 81 5.19 body mass (VT:0001259) body weight (CMO:0000012) 3 41874578 155617519 Rat 1581546 Pur13 Proteinuria QTL 13 2.93 0.0335 urine total protein amount (VT:0000032) urine protein excretion rate (CMO:0000759) 3 78196190 146592722 Rat 1578656 Vnigr2 Vascular neointimal growth QTL 2 4.2 artery morphology trait (VT:0002191) lesioned artery residual lumen area (CMO:0001417) 3 130656562 169034231 Rat 8552952 Pigfal13 Plasma insulin-like growth factor 1 level QTL 13 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 3 138799500 169034231 Rat 631541 Bp81 Blood pressure QTL 81 4 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 3 124122556 169034231 Rat 2293087 Iddm27 Insulin dependent diabetes mellitus QTL 27 2.68 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 3 97551417 147415807 Rat 2312670 Bw94 Body weight QTL 94 0.01 inguinal fat pad mass (VT:0010424) inguinal fat pad weight to body weight ratio (CMO:0001253) 3 98535255 168026850 Rat
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSRNOT00000054554
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 3 144,110,469 - 144,110,533 (+) Ensembl Rnor_6.0 Ensembl 3 151,138,862 - 151,138,926 (+) Ensembl
RefSeq Acc Id:
NR_032141
RefSeq Status:
PROVISIONAL
Type:
NON-CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 3 164,570,612 - 164,570,676 (+) NCBI mRatBN7.2 3 144,110,469 - 144,110,533 (+) NCBI Rnor_6.0 3 151,138,862 - 151,138,926 (+) NCBI Rnor_5.0 3 157,506,669 - 157,506,733 (+) NCBI Celera 3 142,834,661 - 142,834,725 (+) NCBI
Sequence:
GCTGTTAAGACTTGCAGTGATGTTTAGCTCCTCTCCATGTGAACATCACAGCAAGTCTGTGCTGC
hide sequence
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2017-05-23
Mir499a
microRNA 499a
Mir499
microRNA 499
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2015-04-09
Mir499
microRNA 499
Mir499
microRNA mir-499
Name updated
61478 APPROVED
2010-06-02
Mir499
microRNA mir-499
Symbol and Name status set to provisional
70820 PROVISIONAL
