Symbol:
Dusp16
Name:
dual specificity phosphatase 16
RGD ID:
1620783
MGI Page
MGI
Description:
Predicted to enable phosphoprotein phosphatase activity; protein carrier chaperone; and protein kinase binding activity. Predicted to be involved in dephosphorylation; negative regulation of MAPK cascade; and signal transduction. Predicted to be located in nucleoplasm. Predicted to be active in cytoplasm and nucleus. Is expressed in several structures, including alimentary system; genitourinary system; nervous system; respiratory system; and sensory organ. Orthologous to human DUSP16 (dual specificity phosphatase 16).
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
3830417M17Rik; AW558566; D6Ertd213; D6Ertd213e; dual specificity protein phosphatase 16; MAP kinase phosphatase-7; map kinase phosphatase-M; MKP; MKP-; MKP-7; MKP7; Mkpm
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 6 134,692,431 - 134,769,687 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 6 134,692,431 - 134,769,588 (-) Ensembl GRCm39 Ensembl GRCm38 6 134,715,468 - 134,807,063 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 6 134,715,468 - 134,792,625 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 6 134,665,491 - 134,742,646 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 6 134,681,161 - 134,758,168 (-) NCBI MGSCv36 mm8 Celera 6 137,667,708 - 137,745,584 (-) NCBI Celera Cytogenetic Map 6 G1 NCBI cM Map 6 65.77 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Dusp16 Mouse (+)-schisandrin B multiple interactions ISO Dusp16 (Rattus norvegicus) 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in increased expression of DUSP16 mRNA] CTD PMID:31150632 Dusp16 Mouse 1,2-dimethylhydrazine decreases expression EXP 6480464 1 and 2-Dimethylhydrazine results in decreased expression of DUSP16 mRNA CTD PMID:22206623 Dusp16 Mouse 1-naphthyl isothiocyanate increases expression ISO Dusp16 (Rattus norvegicus) 6480464 1-Naphthylisothiocyanate results in increased expression of DUSP16 mRNA CTD PMID:25380136 Dusp16 Mouse 17beta-estradiol decreases expression EXP 6480464 Estradiol results in decreased expression of DUSP16 mRNA CTD PMID:39298647 Dusp16 Mouse 2,3',4,4',5-Pentachlorobiphenyl increases expression EXP 6480464 2 more ... CTD PMID:31388691 Dusp16 Mouse 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Dusp16 (Rattus norvegicus) 6480464 Tetrachlorodibenzodioxin affects the expression of DUSP16 mRNA CTD PMID:22298810 Dusp16 Mouse 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of DUSP16 mRNA CTD PMID:21570461 Dusp16 Mouse 2-palmitoylglycerol increases expression ISO DUSP16 (Homo sapiens) 6480464 2-palmitoylglycerol results in increased expression of DUSP16 mRNA CTD PMID:37199045 Dusp16 Mouse 4,4'-diaminodiphenylmethane increases expression ISO Dusp16 (Rattus norvegicus) 6480464 4 and 4'-diaminodiphenylmethane results in increased expression of DUSP16 mRNA CTD PMID:25380136 Dusp16 Mouse 4,4'-sulfonyldiphenol affects expression EXP 6480464 bisphenol S affects the expression of DUSP16 mRNA CTD PMID:39298647 Dusp16 Mouse 4-hydroxyphenyl retinamide increases expression EXP 6480464 Fenretinide results in increased expression of DUSP16 mRNA CTD PMID:28973697 Dusp16 Mouse 6-propyl-2-thiouracil increases expression ISO Dusp16 (Rattus norvegicus) 6480464 Propylthiouracil results in increased expression of DUSP16 mRNA CTD PMID:30047161 Dusp16 Mouse 8-Br-cAMP increases expression ISO DUSP16 (Homo sapiens) 6480464 8-Bromo Cyclic Adenosine Monophosphate results in increased expression of DUSP16 mRNA CTD PMID:22079614 Dusp16 Mouse acetamide affects expression ISO Dusp16 (Rattus norvegicus) 6480464 acetamide affects the expression of DUSP16 mRNA CTD PMID:31881176 Dusp16 Mouse aflatoxin B1 decreases methylation ISO DUSP16 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of DUSP16 gene CTD PMID:27153756 Dusp16 Mouse all-trans-retinoic acid increases expression ISO DUSP16 (Homo sapiens) 6480464 Tretinoin results in increased expression of DUSP16 mRNA CTD PMID:23724009 and PMID:33167477 Dusp16 Mouse alpha-Zearalanol multiple interactions ISO Dusp16 (Rattus norvegicus) 6480464 [Zeranol co-treated with perfluorooctanoic acid] results in decreased expression of DUSP16 mRNA CTD PMID:35163327 Dusp16 Mouse amitrole increases expression ISO Dusp16 (Rattus norvegicus) 6480464 Amitrole results in increased expression of DUSP16 mRNA CTD PMID:30047161 Dusp16 Mouse antirheumatic drug increases expression ISO DUSP16 (Homo sapiens) 6480464 Antirheumatic Agents results in increased expression of DUSP16 mRNA CTD PMID:24449571 Dusp16 Mouse arsane increases methylation ISO DUSP16 (Homo sapiens) 6480464 Arsenic results in increased methylation of DUSP16 gene CTD PMID:24525453 Dusp16 Mouse arsane multiple interactions ISO DUSP16 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of DUSP16 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of DUSP16 mRNA CTD PMID:39836092 Dusp16 Mouse arsenic atom increases methylation ISO DUSP16 (Homo sapiens) 6480464 Arsenic results in increased methylation of DUSP16 gene CTD PMID:24525453 Dusp16 Mouse arsenic atom multiple interactions ISO DUSP16 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of DUSP16 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of DUSP16 mRNA CTD PMID:39836092 Dusp16 Mouse arsenite(3-) decreases expression EXP 6480464 arsenite results in decreased expression of DUSP16 mRNA CTD PMID:33053406 Dusp16 Mouse arsenite(3-) increases methylation ISO DUSP16 (Homo sapiens) 6480464 arsenite results in increased methylation of DUSP16 promoter CTD PMID:23974009 Dusp16 Mouse arsenous acid decreases expression ISO DUSP16 (Homo sapiens) 6480464 Arsenic Trioxide results in decreased expression of DUSP16 mRNA CTD PMID:20458559 Dusp16 Mouse atrazine affects methylation ISO Dusp16 (Rattus norvegicus) 6480464 Atrazine affects the methylation of DUSP16 gene CTD PMID:28931070 Dusp16 Mouse benzo[a]pyrene increases expression EXP 6480464 Benzo(a)pyrene results in increased expression of DUSP16 mRNA CTD PMID:22228805 Dusp16 Mouse benzo[a]pyrene affects methylation ISO DUSP16 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of DUSP16 5' UTR CTD PMID:27901495 Dusp16 Mouse benzo[a]pyrene decreases expression EXP 6480464 Benzo(a)pyrene results in decreased expression of DUSP16 mRNA CTD PMID:19770486 and PMID:22228805 Dusp16 Mouse beta-lapachone increases expression ISO DUSP16 (Homo sapiens) 6480464 beta-lapachone results in increased expression of DUSP16 mRNA CTD PMID:38218311 Dusp16 Mouse bisphenol A decreases expression ISO DUSP16 (Homo sapiens) 6480464 bisphenol A results in decreased expression of DUSP16 mRNA CTD PMID:22576693 Dusp16 Mouse bisphenol A decreases expression ISO Dusp16 (Rattus norvegicus) 6480464 bisphenol A results in decreased expression of DUSP16 mRNA CTD PMID:34947998 Dusp16 Mouse bisphenol A increases expression ISO DUSP16 (Homo sapiens) 6480464 bisphenol A results in increased expression of DUSP16 mRNA CTD PMID:33670352 Dusp16 Mouse bisphenol A increases expression ISO Dusp16 (Rattus norvegicus) 6480464 bisphenol A results in increased expression of DUSP16 mRNA CTD PMID:32145629 Dusp16 Mouse bisphenol A affects expression ISO Dusp16 (Rattus norvegicus) 6480464 bisphenol A affects the expression of DUSP16 mRNA CTD PMID:25181051 Dusp16 Mouse bisphenol A increases methylation ISO DUSP16 (Homo sapiens) 6480464 bisphenol A results in increased methylation of DUSP16 gene CTD PMID:22576693 Dusp16 Mouse bisphenol F multiple interactions ISO DUSP16 (Homo sapiens) 6480464 [bisphenol F co-treated with Fulvestrant] results in decreased methylation of DUSP16 gene CTD PMID:31601247 Dusp16 Mouse bisphenol F increases expression EXP 6480464 bisphenol F results in increased expression of DUSP16 mRNA CTD PMID:38685157 Dusp16 Mouse caffeine decreases phosphorylation ISO DUSP16 (Homo sapiens) 6480464 Caffeine results in decreased phosphorylation of DUSP16 protein CTD PMID:35688186 Dusp16 Mouse carbon nanotube decreases expression EXP 6480464 Nanotubes and Carbon analog results in decreased expression of DUSP16 mRNA CTD PMID:25554681 Dusp16 Mouse chlorpyrifos increases expression EXP 6480464 Chlorpyrifos results in increased expression of DUSP16 mRNA CTD PMID:34289071 Dusp16 Mouse cisplatin increases expression ISO DUSP16 (Homo sapiens) 6480464 Cisplatin results in increased expression of DUSP16 mRNA CTD PMID:27594783 Dusp16 Mouse clofibrate multiple interactions EXP 6480464 [Clofibrate co-treated with Acetaminophen] affects the expression of DUSP16 mRNA and PPARA affects the reaction [[Clofibrate co-treated with Acetaminophen] affects the expression of DUSP16 mRNA] CTD PMID:17585979 Dusp16 Mouse clothianidin decreases expression ISO DUSP16 (Homo sapiens) 6480464 clothianidin results in decreased expression of DUSP16 mRNA CTD PMID:31626844 Dusp16 Mouse copper atom multiple interactions EXP 6480464 [ATP7A gene mutant form results in increased abundance of Copper] which results in increased expression of DUSP16 mRNA CTD PMID:15467011 Dusp16 Mouse copper atom multiple interactions ISO DUSP16 (Homo sapiens) 6480464 [Chelating Agents binds to Copper] which results in increased expression of DUSP16 mRNA CTD PMID:30911355 Dusp16 Mouse copper(0) multiple interactions EXP 6480464 [ATP7A gene mutant form results in increased abundance of Copper] which results in increased expression of DUSP16 mRNA CTD PMID:15467011 Dusp16 Mouse copper(0) multiple interactions ISO DUSP16 (Homo sapiens) 6480464 [Chelating Agents binds to Copper] which results in increased expression of DUSP16 mRNA CTD PMID:30911355 Dusp16 Mouse Cuprizon increases expression ISO Dusp16 (Rattus norvegicus) 6480464 Cuprizone results in increased expression of DUSP16 mRNA CTD PMID:26577399 Dusp16 Mouse cyclosporin A increases expression ISO DUSP16 (Homo sapiens) 6480464 Cyclosporine results in increased expression of DUSP16 mRNA CTD PMID:20106945 and PMID:25562108 Dusp16 Mouse cylindrospermopsin increases expression ISO DUSP16 (Homo sapiens) 6480464 cylindrospermopsin results in increased expression of DUSP16 mRNA CTD PMID:24921660 Dusp16 Mouse DDE decreases expression ISO DUSP16 (Homo sapiens) 6480464 Dichlorodiphenyl Dichloroethylene results in decreased expression of DUSP16 mRNA CTD PMID:38568856 Dusp16 Mouse diarsenic trioxide decreases expression ISO DUSP16 (Homo sapiens) 6480464 Arsenic Trioxide results in decreased expression of DUSP16 mRNA CTD PMID:20458559 Dusp16 Mouse Dibutyl phosphate affects expression ISO DUSP16 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of DUSP16 mRNA CTD PMID:37042841 Dusp16 Mouse dibutyl phthalate increases expression ISO Dusp16 (Rattus norvegicus) 6480464 Dibutyl Phthalate results in increased expression of DUSP16 mRNA CTD PMID:21266533 Dusp16 Mouse dibutyl phthalate increases expression EXP 6480464 Dibutyl Phthalate results in increased expression of DUSP16 mRNA CTD PMID:17361019 and PMID:21266533 Dusp16 Mouse entinostat decreases expression ISO DUSP16 (Homo sapiens) 6480464 entinostat results in decreased expression of DUSP16 mRNA CTD PMID:27188386 Dusp16 Mouse fipronil increases expression ISO Dusp16 (Rattus norvegicus) 6480464 fipronil results in increased expression of DUSP16 mRNA CTD PMID:23962444 Dusp16 Mouse fluoranthene multiple interactions EXP 6480464 [1-methylanthracene co-treated with fluoranthene] results in increased expression of DUSP16 mRNA CTD PMID:28329830 Dusp16 Mouse FR900359 decreases phosphorylation ISO DUSP16 (Homo sapiens) 6480464 FR900359 results in decreased phosphorylation of DUSP16 protein CTD PMID:37730182 Dusp16 Mouse fulvestrant decreases methylation ISO DUSP16 (Homo sapiens) 6480464 Fulvestrant results in decreased methylation of DUSP16 gene CTD PMID:31601247 Dusp16 Mouse fulvestrant multiple interactions ISO DUSP16 (Homo sapiens) 6480464 [bisphenol F co-treated with Fulvestrant] results in decreased methylation of DUSP16 gene CTD PMID:31601247 Dusp16 Mouse fumonisin B1 increases expression EXP 6480464 fumonisin B1 results in increased expression of DUSP16 mRNA CTD PMID:16221962 Dusp16 Mouse gentamycin increases expression ISO Dusp16 (Rattus norvegicus) 6480464 Gentamicins results in increased expression of DUSP16 mRNA CTD PMID:33387578 Dusp16 Mouse glycidol decreases expression ISO Dusp16 (Rattus norvegicus) 6480464 glycidol results in decreased expression of DUSP16 mRNA CTD PMID:24915197 Dusp16 Mouse glyphosate decreases expression ISO DUSP16 (Homo sapiens) 6480464 Glyphosate results in decreased expression of DUSP16 mRNA CTD PMID:31295307 Dusp16 Mouse lead diacetate decreases expression EXP 6480464 lead acetate results in decreased expression of DUSP16 mRNA CTD PMID:21829687 Dusp16 Mouse leflunomide increases expression ISO DUSP16 (Homo sapiens) 6480464 leflunomide results in increased expression of DUSP16 mRNA CTD PMID:28988120 Dusp16 Mouse lipopolysaccharide increases expression ISO DUSP16 (Homo sapiens) 6480464 Lipopolysaccharides results in increased expression of DUSP16 mRNA CTD PMID:35811015 Dusp16 Mouse lipopolysaccharide multiple interactions ISO DUSP16 (Homo sapiens) 6480464 [S-(1 more ... CTD PMID:35811015 Dusp16 Mouse manganese atom multiple interactions ISO DUSP16 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of DUSP16 mRNA CTD PMID:39836092 Dusp16 Mouse manganese(0) multiple interactions ISO DUSP16 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of DUSP16 mRNA CTD PMID:39836092 Dusp16 Mouse manganese(II) chloride multiple interactions ISO DUSP16 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of DUSP16 mRNA CTD PMID:39836092 Dusp16 Mouse MeIQx increases expression ISO DUSP16 (Homo sapiens) 6480464 2-amino-3 more ... CTD PMID:20816883 Dusp16 Mouse methimazole increases expression ISO Dusp16 (Rattus norvegicus) 6480464 Methimazole results in increased expression of DUSP16 mRNA CTD PMID:30047161 Dusp16 Mouse methylmercury chloride increases expression ISO DUSP16 (Homo sapiens) 6480464 methylmercuric chloride results in increased expression of DUSP16 mRNA CTD PMID:28001369 Dusp16 Mouse N(4)-hydroxycytidine decreases expression EXP 6480464 N(4)-hydroxycytidine results in decreased expression of DUSP16 mRNA CTD PMID:37748715 Dusp16 Mouse N-nitrosodimethylamine increases expression ISO Dusp16 (Rattus norvegicus) 6480464 Dimethylnitrosamine results in increased expression of DUSP16 mRNA CTD PMID:25380136 Dusp16 Mouse orphenadrine affects expression ISO Dusp16 (Rattus norvegicus) 6480464 Orphenadrine affects the expression of DUSP16 mRNA CTD PMID:23665939 Dusp16 Mouse paracetamol multiple interactions EXP 6480464 [Clofibrate co-treated with Acetaminophen] affects the expression of DUSP16 mRNA and PPARA affects the reaction [[Clofibrate co-treated with Acetaminophen] affects the expression of DUSP16 mRNA] CTD PMID:17585979 Dusp16 Mouse paracetamol decreases expression ISO DUSP16 (Homo sapiens) 6480464 Acetaminophen results in decreased expression of DUSP16 mRNA CTD PMID:21420995 Dusp16 Mouse paracetamol affects expression EXP 6480464 Acetaminophen affects the expression of DUSP16 mRNA CTD PMID:17562736 Dusp16 Mouse paraquat increases expression ISO Dusp16 (Rattus norvegicus) 6480464 Paraquat results in increased expression of DUSP16 mRNA CTD PMID:32680482 Dusp16 Mouse perfluorohexanesulfonic acid decreases expression EXP 6480464 perfluorohexanesulfonic acid results in decreased expression of DUSP16 mRNA CTD PMID:37995155 Dusp16 Mouse perfluorooctanoic acid multiple interactions ISO Dusp16 (Rattus norvegicus) 6480464 [Zeranol co-treated with perfluorooctanoic acid] results in decreased expression of DUSP16 mRNA CTD PMID:35163327 Dusp16 Mouse pirinixic acid multiple interactions EXP 6480464 [pirinixic acid binds to and results in increased activity of PPARA protein] which results in decreased expression of DUSP16 mRNA CTD PMID:19710929 Dusp16 Mouse pirinixic acid decreases expression EXP 6480464 pirinixic acid results in decreased expression of DUSP16 mRNA CTD PMID:17426115 Dusp16 Mouse potassium chromate decreases expression ISO DUSP16 (Homo sapiens) 6480464 potassium chromate(VI) results in decreased expression of DUSP16 mRNA CTD PMID:22714537 Dusp16 Mouse rotenone increases expression ISO DUSP16 (Homo sapiens) 6480464 Rotenone results in increased expression of DUSP16 mRNA CTD PMID:29955902 Dusp16 Mouse S-(1,2-dichlorovinyl)-L-cysteine multiple interactions ISO DUSP16 (Homo sapiens) 6480464 [S-(1 more ... CTD PMID:35811015 Dusp16 Mouse sertraline increases expression ISO DUSP16 (Homo sapiens) 6480464 Sertraline results in increased expression of DUSP16 mRNA CTD PMID:24865413 Dusp16 Mouse sevoflurane affects expression ISO Dusp16 (Rattus norvegicus) 6480464 sevoflurane affects the expression of DUSP16 mRNA CTD PMID:15967596 Dusp16 Mouse silicon dioxide increases expression ISO DUSP16 (Homo sapiens) 6480464 Silicon Dioxide analog results in increased expression of DUSP16 mRNA CTD PMID:25895662 Dusp16 Mouse silicon dioxide increases expression EXP 6480464 Silicon Dioxide results in increased expression of DUSP16 mRNA CTD PMID:19073995 and PMID:33720480 Dusp16 Mouse silver atom decreases expression EXP 6480464 Silver results in decreased expression of DUSP16 mRNA CTD PMID:27131904 Dusp16 Mouse silver(0) decreases expression EXP 6480464 Silver results in decreased expression of DUSP16 mRNA CTD PMID:27131904 Dusp16 Mouse sodium arsenate increases expression EXP 6480464 sodium arsenate results in increased expression of DUSP16 mRNA CTD PMID:21795629 Dusp16 Mouse sodium arsenite decreases expression ISO DUSP16 (Homo sapiens) 6480464 sodium arsenite results in decreased expression of DUSP16 mRNA CTD PMID:34032870 Dusp16 Mouse sodium arsenite decreases expression ISO Dusp16 (Rattus norvegicus) 6480464 sodium arsenite results in decreased expression of DUSP16 mRNA CTD PMID:35314868 Dusp16 Mouse sodium arsenite multiple interactions ISO DUSP16 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of DUSP16 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of DUSP16 mRNA CTD PMID:39836092 Dusp16 Mouse sodium dichromate increases expression ISO Dusp16 (Rattus norvegicus) 6480464 sodium bichromate results in increased expression of DUSP16 mRNA CTD PMID:25993096 Dusp16 Mouse sulfadimethoxine increases expression ISO Dusp16 (Rattus norvegicus) 6480464 Sulfadimethoxine results in increased expression of DUSP16 mRNA CTD PMID:30047161 Dusp16 Mouse sulforaphane increases expression ISO DUSP16 (Homo sapiens) 6480464 sulforaphane results in increased expression of DUSP16 mRNA CTD PMID:26833863 Dusp16 Mouse sulforaphane decreases expression ISO DUSP16 (Homo sapiens) 6480464 sulforaphane results in decreased expression of DUSP16 mRNA CTD PMID:31838189 Dusp16 Mouse sunitinib decreases expression ISO DUSP16 (Homo sapiens) 6480464 Sunitinib results in decreased expression of DUSP16 mRNA CTD PMID:31533062 Dusp16 Mouse tetrachloromethane multiple interactions ISO Dusp16 (Rattus norvegicus) 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in increased expression of DUSP16 mRNA] CTD PMID:31150632 Dusp16 Mouse tetrachloromethane increases expression EXP 6480464 Carbon Tetrachloride results in increased expression of DUSP16 mRNA CTD PMID:31919559 Dusp16 Mouse tetrachloromethane increases expression ISO Dusp16 (Rattus norvegicus) 6480464 Carbon Tetrachloride results in increased expression of DUSP16 mRNA CTD PMID:31150632 Dusp16 Mouse thioacetamide increases expression ISO Dusp16 (Rattus norvegicus) 6480464 Thioacetamide results in increased expression of DUSP16 mRNA CTD PMID:23411599 and PMID:34492290 Dusp16 Mouse thiram increases expression ISO DUSP16 (Homo sapiens) 6480464 Thiram results in increased expression of DUSP16 mRNA CTD PMID:38568856 Dusp16 Mouse titanium dioxide increases methylation EXP 6480464 titanium dioxide results in increased methylation of DUSP16 gene CTD PMID:35295148 Dusp16 Mouse torcetrapib increases expression ISO DUSP16 (Homo sapiens) 6480464 torcetrapib results in increased expression of DUSP16 mRNA CTD PMID:23228038 Dusp16 Mouse trichloroethene increases expression ISO Dusp16 (Rattus norvegicus) 6480464 Trichloroethylene results in increased expression of DUSP16 mRNA CTD PMID:33387578 Dusp16 Mouse troglitazone increases expression ISO DUSP16 (Homo sapiens) 6480464 troglitazone results in increased expression of DUSP16 mRNA CTD PMID:19140230 Dusp16 Mouse trovafloxacin multiple interactions EXP 6480464 [trovafloxacin co-treated with lipopolysaccharide and E coli O55-B5] results in increased expression of DUSP16 mRNA CTD PMID:18930950 Dusp16 Mouse tunicamycin increases expression EXP 6480464 Tunicamycin results in increased expression of DUSP16 mRNA CTD PMID:17127020 Dusp16 Mouse valproic acid decreases expression ISO DUSP16 (Homo sapiens) 6480464 Valproic Acid results in decreased expression of DUSP16 mRNA CTD PMID:23179753 and PMID:29154799 Dusp16 Mouse valproic acid decreases methylation ISO DUSP16 (Homo sapiens) 6480464 Valproic Acid results in decreased methylation of DUSP16 gene CTD PMID:29154799 Dusp16 Mouse valproic acid affects expression ISO DUSP16 (Homo sapiens) 6480464 Valproic Acid affects the expression of DUSP16 mRNA CTD PMID:25979313 Dusp16 Mouse vinclozolin increases expression ISO Dusp16 (Rattus norvegicus) 6480464 vinclozolin results in increased expression of DUSP16 mRNA CTD PMID:22570695 Dusp16 Mouse vincristine increases expression ISO DUSP16 (Homo sapiens) 6480464 Vincristine results in increased expression of DUSP16 mRNA CTD PMID:23649840 Dusp16 Mouse vorinostat increases expression ISO DUSP16 (Homo sapiens) 6480464 vorinostat results in increased expression of DUSP16 mRNA CTD PMID:27188386 Dusp16 Mouse zinc atom multiple interactions ISO DUSP16 (Homo sapiens) 6480464 [PCI 5002 co-treated with Zinc] results in increased expression of DUSP16 mRNA CTD PMID:18593933 Dusp16 Mouse zinc(0) multiple interactions ISO DUSP16 (Homo sapiens) 6480464 [PCI 5002 co-treated with Zinc] results in increased expression of DUSP16 mRNA CTD PMID:18593933
Imported Annotations - KEGG (archival)
(+)-schisandrin B (ISO) 1,2-dimethylhydrazine (EXP) 1-naphthyl isothiocyanate (ISO) 17beta-estradiol (EXP) 2,3',4,4',5-Pentachlorobiphenyl (EXP) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2-palmitoylglycerol (ISO) 4,4'-diaminodiphenylmethane (ISO) 4,4'-sulfonyldiphenol (EXP) 4-hydroxyphenyl retinamide (EXP) 6-propyl-2-thiouracil (ISO) 8-Br-cAMP (ISO) acetamide (ISO) aflatoxin B1 (ISO) all-trans-retinoic acid (ISO) alpha-Zearalanol (ISO) amitrole (ISO) antirheumatic drug (ISO) arsane (ISO) arsenic atom (ISO) arsenite(3-) (EXP,ISO) arsenous acid (ISO) atrazine (ISO) benzo[a]pyrene (EXP,ISO) beta-lapachone (ISO) bisphenol A (ISO) bisphenol F (EXP,ISO) caffeine (ISO) carbon nanotube (EXP) chlorpyrifos (EXP) cisplatin (ISO) clofibrate (EXP) clothianidin (ISO) copper atom (EXP,ISO) copper(0) (EXP,ISO) Cuprizon (ISO) cyclosporin A (ISO) cylindrospermopsin (ISO) DDE (ISO) diarsenic trioxide (ISO) Dibutyl phosphate (ISO) dibutyl phthalate (EXP,ISO) entinostat (ISO) fipronil (ISO) fluoranthene (EXP) FR900359 (ISO) fulvestrant (ISO) fumonisin B1 (EXP) gentamycin (ISO) glycidol (ISO) glyphosate (ISO) lead diacetate (EXP) leflunomide (ISO) lipopolysaccharide (ISO) manganese atom (ISO) manganese(0) (ISO) manganese(II) chloride (ISO) MeIQx (ISO) methimazole (ISO) methylmercury chloride (ISO) N(4)-hydroxycytidine (EXP) N-nitrosodimethylamine (ISO) orphenadrine (ISO) paracetamol (EXP,ISO) paraquat (ISO) perfluorohexanesulfonic acid (EXP) perfluorooctanoic acid (ISO) pirinixic acid (EXP) potassium chromate (ISO) rotenone (ISO) S-(1,2-dichlorovinyl)-L-cysteine (ISO) sertraline (ISO) sevoflurane (ISO) silicon dioxide (EXP,ISO) silver atom (EXP) silver(0) (EXP) sodium arsenate (EXP) sodium arsenite (ISO) sodium dichromate (ISO) sulfadimethoxine (ISO) sulforaphane (ISO) sunitinib (ISO) tetrachloromethane (EXP,ISO) thioacetamide (ISO) thiram (ISO) titanium dioxide (EXP) torcetrapib (ISO) trichloroethene (ISO) troglitazone (ISO) trovafloxacin (EXP) tunicamycin (EXP) valproic acid (ISO) vinclozolin (ISO) vincristine (ISO) vorinostat (ISO) zinc atom (ISO) zinc(0) (ISO)
Dusp16 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 6 134,692,431 - 134,769,687 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 6 134,692,431 - 134,769,588 (-) Ensembl GRCm39 Ensembl GRCm38 6 134,715,468 - 134,807,063 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 6 134,715,468 - 134,792,625 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 6 134,665,491 - 134,742,646 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 6 134,681,161 - 134,758,168 (-) NCBI MGSCv36 mm8 Celera 6 137,667,708 - 137,745,584 (-) NCBI Celera Cytogenetic Map 6 G1 NCBI cM Map 6 65.77 NCBI
DUSP16 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 12 12,473,282 - 12,562,863 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 12 12,473,282 - 12,562,863 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 12 12,626,216 - 12,715,797 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 12 12,520,098 - 12,606,584 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 12 12,520,097 - 12,606,584 NCBI Celera 12 17,770,364 - 17,859,590 (-) NCBI Celera Cytogenetic Map 12 p13.2 NCBI HuRef 12 12,391,458 - 12,480,660 (-) NCBI HuRef CHM1_1 12 12,591,206 - 12,680,469 (-) NCBI CHM1_1 T2T-CHM13v2.0 12 12,342,454 - 12,456,119 (-) NCBI T2T-CHM13v2.0
Dusp16 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 169,278,118 - 169,361,508 (-) NCBI GRCr8 mRatBN7.2 4 167,546,780 - 167,630,173 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 167,548,155 - 167,629,980 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 173,842,654 - 173,887,018 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 169,625,735 - 169,670,100 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 168,249,393 - 168,293,749 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 168,470,141 - 168,551,346 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 168,472,412 - 168,517,177 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 232,751,520 - 232,802,419 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 171,620,395 - 171,667,593 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 4 171,868,691 - 171,912,166 (-) NCBI Celera 4 156,146,862 - 156,191,111 (-) NCBI Celera Cytogenetic Map 4 q43 NCBI
Dusp16 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955413 9,385,100 - 9,474,711 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955413 9,404,259 - 9,481,061 (-) NCBI ChiLan1.0 ChiLan1.0
DUSP16 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 10 17,940,580 - 18,028,994 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 12 17,937,339 - 18,025,752 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 12 12,497,185 - 12,585,591 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 12 12,865,400 - 12,963,732 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 12 12,865,400 - 12,912,502 (-) Ensembl panpan1.1 panPan2
DUSP16 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 27 33,728,209 - 33,831,258 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 27 33,789,557 - 33,832,075 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 27 12,612,785 - 12,734,244 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 27 34,055,803 - 34,140,045 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 27 34,019,158 - 34,137,506 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 27 33,948,602 - 34,032,763 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 27 33,898,280 - 33,982,495 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 27 12,346,927 - 12,468,377 (-) NCBI UU_Cfam_GSD_1.0
Dusp16 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024404945 94,983,450 - 95,075,107 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936587 4,711,388 - 4,801,382 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936587 4,711,085 - 4,801,030 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
DUSP16
DUSP16 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 11 12,369,713 - 12,462,134 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 11 12,372,449 - 12,419,136 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666069 22,857,949 - 22,950,225 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Dusp16
.
Predicted Target Of
Count of predictions: 948 Count of miRNA genes: 572 Interacting mature miRNAs: 680 Transcripts: ENSMUST00000100857, ENSMUST00000129433, ENSMUST00000148926, ENSMUST00000149776 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
4142079 Skmw15_m skeletal muscle weight 15 (mouse) Not determined 6 116829851 149588044 Mouse 10043864 T2dm4sa_m type 2 diabetes mellitus 4 in SMXA RI mice (mouse) Not determined 6 83690851 146954059 Mouse 11252138 Clas1_m carcinogen-induced lung adenoma susceptibility 1 (mouse) 6 112246918 146954059 Mouse 10449437 Pas15_m pulmonary adenoma susceptibility 15 (mouse) 6 128180868 149588044 Mouse 10449436 Pas17_m pulmonary adenoma susceptibility 17 (mouse) 6 124334273 145601739 Mouse 1300887 Pabr1_m plasma apolipoprotein B (human) regulator 1 (mouse) Not determined 6 103754405 136400690 Mouse 1301658 Radpf3_m radiation pulmonary fibrosis 3 (mouse) Not determined 6 115219814 146330736 Mouse 4141940 W6q5_m weight 6 weeks QTL 5 (mouse) Not determined 96632912 146535124 Mouse 4140980 Mvwf2_m modifier of von Willebrand factor 2 (mouse) Not determined 114345693 145601739 Mouse 4142259 Tabw2_m tally ho associated body weight 2 (mouse) Not determined 46912919 136400690 Mouse 1301084 Bpq5_m blood pressure QTL 5 (mouse) Not determined 6 129330484 149588044 Mouse 14746990 Manh61_m mandible shape 61 (mouse) 6 130156355 149588044 Mouse 4141295 Rua_m raffinose acetate tasting (mouse) Not determined 115546805 149549364 Mouse 10766452 Sle23_m systematic lupus erythematosus susceptibility 23 (mouse) 6 128601582 149588044 Mouse 25314320 Histh5_m histamine hypersensitivity 5 (mouse) 6 48696934 148351498 Mouse 14746999 Mancz6_m mandible centroid size 6 (mouse) 6 130156355 149588044 Mouse 1302089 Wta2_m weight adult 2 (mouse) Not determined 6 125269523 149588044 Mouse 1301518 Bbaa5_m B.burgdorferi-associated arthritis 5 (mouse) Not determined 6 98483798 145881170 Mouse 11353842 Bmiq4_m body mass index QTL 4 (mouse) 6 92584287 146330736 Mouse 4141151 Ath38_m atherosclerosis 38 (mouse) Not determined 128495857 136293176 Mouse 26884414 Bzwq12_m bi-zygomatic width QTL 12, 16 week (mouse) 6 3400000 139076998 Mouse 1301686 Trmq1_m T cell ratio modifier QTL 1 (mouse) Not determined 6 129330484 149588044 Mouse 1357555 Tesq2_m testis weight QTL 2 (mouse) Not determined 6 96632912 146535124 Mouse 1301620 Insq8_m insulin QTL 8 (mouse) Not determined 6 129534979 149588044 Mouse 12879916 Shm5_m sperm head morphology 5 (mouse) 6 132266532 145601739 Mouse 10053680 Lith25_m lithogenic gene 25 (mouse) Not determined 6 128601582 149588044 Mouse 10412215 Cmv3_m cytomegalovirus resistance 3 (mouse) Not determined 6 128811857 137416927 Mouse 4141974 Skmw14_m skeletal muscle weight 14 (mouse) Not determined 6 129330484 149588044 Mouse 12910121 Lvic3_m liver iron content 3 (mouse) 6 134096413 136022150 Mouse 4142416 Egq11_m early growth QTL 11 (mouse) Not determined 96632912 146535124 Mouse 1301820 Mop1_m morphine preference 1 (mouse) Not determined 6 132578005 146330736 Mouse 1301027 Hdlq12_m HDL QTL 12 (mouse) Not determined 6 128601582 149588044 Mouse 10412207 Cypr5_m cytokine production 5 (mouse) Not determined 6 110815180 144815323 Mouse 1301152 Athsq2_m atherosclerosis susceptibility QTL 2 (mouse) Not determined 6 117059949 149588044 Mouse 13463481 Mcvq14_m mean corpuscular volume QTL 14 (mouse) 6 111142448 145142541 Mouse 1301927 Etohcta6_m ethanol conditioned taste aversion 6 (mouse) Not determined 6 115578005 149578150 Mouse 4141194 Cyx_m cycloheximide tasting (mouse) Not determined 115546805 149549364 Mouse 10412134 Cmv4_m cytomegalovirus resistance 4 (mouse) Not determined 6 127815180 136022150 Mouse 1558959 Eamcd2_m experimental autoimmune myocarditis 2 (mouse) Not determined 6 129953954 149588044 Mouse 1357806 Aaj3_m anxiety in A/J 3 (mouse) Not determined 6 104480321 136400690 Mouse 4141889 Qui_m quinine sensitivity, taste (mouse) Not determined 115546805 149549364 Mouse 1301804 Bulb2_m bulb size 2 (mouse) Not determined 6 120416806 149588044 Mouse
AW558566
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 6 134,715,641 - 134,715,723 UniSTS GRCm38 MGSCv37 6 134,665,659 - 134,665,741 UniSTS GRCm37 Celera 6 137,667,876 - 137,667,977 UniSTS Cytogenetic Map 6 G1 UniSTS cM Map 6 62.0 UniSTS Whitehead/MRC_RH 6 1562.68 UniSTS
RH126445
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 6 134,737,602 - 134,737,819 UniSTS GRCm38 MGSCv37 6 134,687,620 - 134,687,837 UniSTS GRCm37 Celera 6 137,689,630 - 137,689,847 UniSTS Cytogenetic Map 6 G1 UniSTS cM Map 6 62.0 UniSTS Whitehead/MRC_RH 6 1556.32 UniSTS
Dusp16
Mouse Assembly Chr Position (strand) Source JBrowse Cytogenetic Map 6 G1 UniSTS cM Map 6 62.0 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000100857 ⟹ ENSMUSP00000098419
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 6 134,692,436 - 134,769,588 (-) Ensembl GRCm38.p6 Ensembl 6 134,715,473 - 134,792,625 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000129433 ⟹ ENSMUSP00000115925
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 6 134,692,431 - 134,769,438 (-) Ensembl GRCm38.p6 Ensembl 6 134,715,468 - 134,792,475 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000148926 ⟹ ENSMUSP00000144917
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 6 134,697,542 - 134,735,683 (-) Ensembl GRCm38.p6 Ensembl 6 134,720,579 - 134,758,720 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000149776 ⟹ ENSMUSP00000144784
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 6 134,714,459 - 134,768,297 (-) Ensembl GRCm38.p6 Ensembl 6 134,737,496 - 134,791,334 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000203452
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 6 134,695,885 - 134,720,789 (-) Ensembl GRCm38.p6 Ensembl 6 134,718,922 - 134,743,826 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000203651
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 6 134,695,733 - 134,703,021 (-) Ensembl GRCm38.p6 Ensembl 6 134,718,770 - 134,726,058 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000204083 ⟹ ENSMUSP00000144834
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 6 134,694,778 - 134,738,063 (-) Ensembl GRCm38.p6 Ensembl 6 134,717,815 - 134,761,100 (-) Ensembl
RefSeq Acc Id:
NM_001048054 ⟹ NP_001041519
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 6 134,692,431 - 134,769,591 (-) NCBI GRCm38 6 134,715,468 - 134,792,628 (-) NCBI MGSCv37 6 134,665,491 - 134,742,646 (-) RGD Celera 6 137,667,703 - 137,745,584 (-) NCBI cM Map 6 ENTREZGENE
Sequence:
CTCTCTCCCCAACCCCCACACTACCCCCCCTGGTCCCCTCCTGCGGGCATCACCGTTTGGGGGGGCTCTCATCCCGTTTCCAACCATTTACCCTCCCCCTCTCGCTTTTCCCGCGCGGACCCCCAACT
hide sequence
RefSeq Acc Id:
NM_130447 ⟹ NP_569714
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 6 134,692,431 - 134,769,591 (-) NCBI GRCm38 6 134,715,468 - 134,792,628 (-) NCBI MGSCv37 6 134,665,491 - 134,742,646 (-) RGD Celera 6 137,667,703 - 137,745,584 (-) NCBI cM Map 6 ENTREZGENE
Sequence:
CTCTCTCCCCAACCCCCACACTACCCCCCCTGGTCCCCTCCTGCGGGCATCACCGTTTGGGGGG
hide sequence
RefSeq Acc Id:
XM_036152298 ⟹ XP_036008191
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 6 134,692,436 - 134,769,687 (-) NCBI
Sequence:
GTTCATTCACTGGGATTGGTTTCAAGTGACGCCATCTCTTTATTTTTAAACCGATGACCTCATC
hide sequence
RefSeq Acc Id:
XM_036152299 ⟹ XP_036008192
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 6 134,692,436 - 134,769,687 (-) NCBI
Sequence:
GTTCATTCACTGGGATTGGTTTCAAGTGACGCCATCTCTTTATTTTTAAACCGATGACCTCATC
hide sequence
RefSeq Acc Id:
NP_569714 ⟸ NM_130447
- Peptide Label:
isoform A1
- UniProtKB:
Q6PCP3 (UniProtKB/TrEMBL), Q920R2 (UniProtKB/TrEMBL)
- Sequence:
MAHEMIGTQIVTESLVALLESGTEKVLLIDSRPFVEYNTSHILEAININCSKLMKRRLQQDKVLITELIQHSAKHKVDIDCNQKVVVYDQSSQDVGSLSSDCFLTVLLGKLERSFNSVHLLAGGFAEF
hide sequence
RefSeq Acc Id:
NP_001041519 ⟸ NM_001048054
- Peptide Label:
isoform B1
- UniProtKB:
F6UIK0 (UniProtKB/TrEMBL), Q3UMM5 (UniProtKB/TrEMBL)
- Sequence:
MAHEMIGTQIVTESLVALLESGTEKVLLIDSRPFVEYNTSHILEAININCSKLMKRRLQQDKVL
hide sequence
Ensembl Acc Id:
ENSMUSP00000144834 ⟸ ENSMUST00000204083
Ensembl Acc Id:
ENSMUSP00000144784 ⟸ ENSMUST00000149776
Ensembl Acc Id:
ENSMUSP00000115925 ⟸ ENSMUST00000129433
Ensembl Acc Id:
ENSMUSP00000098419 ⟸ ENSMUST00000100857
Ensembl Acc Id:
ENSMUSP00000144917 ⟸ ENSMUST00000148926
RefSeq Acc Id:
XP_036008192 ⟸ XM_036152299
- Peptide Label:
isoform X1
- UniProtKB:
Q6PCP3 (UniProtKB/TrEMBL), Q920R2 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_036008191 ⟸ XM_036152298
- Peptide Label:
isoform X1
- UniProtKB:
Q6PCP3 (UniProtKB/TrEMBL), Q920R2 (UniProtKB/TrEMBL)
RGD ID: 6839203 Promoter ID: MM_KWN:47980 Type: Non-CpG SO ACC ID: SO:0000170 Source: MPROMDB Tissues & Cell Lines: BoneMarrow_2Hour Transcripts: OTTMUST00000056333 Position: Mouse Assembly Chr Position (strand) Source MGSCv36 6 134,708,496 - 134,708,996 (-) MPROMDB
RGD ID: 6839202 Promoter ID: MM_KWN:47982 Type: CpG-Island SO ACC ID: SO:0000170 Source: MPROMDB Tissues & Cell Lines: BoneMarrow_0Hour, BoneMarrow_2Hour, BoneMarrow_4Hour, Lung Transcripts: OTTMUST00000056332 Position: Mouse Assembly Chr Position (strand) Source MGSCv36 6 134,741,834 - 134,742,334 (-) MPROMDB
RGD ID: 6839209 Promoter ID: MM_KWN:47983 Type: CpG-Island SO ACC ID: SO:0000170 Source: MPROMDB Tissues & Cell Lines: BoneMarrow_0Hour, BoneMarrow_2Hour, BoneMarrow_4Hour, ES_Cell, Liver, Lung Transcripts: ENSMUST00000065273, ENSMUST00000081261, NM_001048054, NM_130447, UC009EKQ.1, UC009EKR.1 Position: Mouse Assembly Chr Position (strand) Source MGSCv36 6 134,742,636 - 134,743,377 (-) MPROMDB
RGD ID: 6891288 Promoter ID: EPDNEW_M9095 Type: initiation region Name: Dusp16_2 Description: Mus musculus dual specificity phosphatase 16 , transcript variantB1, mRNA. SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Alternative Promoters: null; see alsoEPDNEW_M9096 Experiment Methods: Single-end sequencing. Position: Mouse Assembly Chr Position (strand) Source GRCm38 6 134,791,334 - 134,791,394 EPDNEW
RGD ID: 6891290 Promoter ID: EPDNEW_M9096 Type: initiation region Name: Dusp16_1 Description: Mus musculus dual specificity phosphatase 16 , transcript variantB1, mRNA. SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Alternative Promoters: null; see alsoEPDNEW_M9095 Experiment Methods: Single-end sequencing. Position: Mouse Assembly Chr Position (strand) Source GRCm38 6 134,792,720 - 134,792,780 EPDNEW
