Advanced Search (OLGA)

Gene: Hyi (hydroxypyruvate isomerase (putative)) Mus musculus

Subscribe to Updates

Analyze

Symbol:

Hyi

Name:

hydroxypyruvate isomerase (putative)

RGD ID:

1620018

MGI Page

MGI

Description:

Predicted to enable hydroxypyruvate isomerase activity. Predicted to be involved in glyoxylate metabolic process. Is expressed in brain and nucleus pulposus. Orthologous to human HYI (hydroxypyruvate isomerase (putative)).

Type:

protein-coding

RefSeq Status:

VALIDATED

Previously known as:

2700033B16Rik; 6430559E15Rik; HT036; hydroxypyruvate isomerase homolog; putative hydroxypyruvate isomerase

RGD Orthologs

Alliance Orthologs

More Info

more info ...

More Info

Species	Gene symbol and name	Data Source	Assertion derived from	less info ...
Orthologs ¹				less info ...
Homo sapiens (human):	HYI (hydroxypyruvate isomerase (putative))	HGNC	Ensembl, HGNC, Inparanoid, OrthoDB, OrthoMCL, Panther
Rattus norvegicus (Norway rat):	Hyi (hydroxypyruvate isomerase)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):	Hyi (hydroxypyruvate isomerase (putative))	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):	HYI (hydroxypyruvate isomerase (putative))	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Canis lupus familiaris (dog):	HYI (hydroxypyruvate isomerase (putative))	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):	Hyi (hydroxypyruvate isomerase (putative))	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Sus scrofa (pig):	HYI (hydroxypyruvate isomerase (putative))	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):	HYI (hydroxypyruvate isomerase (putative))	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):	Hyi (hydroxypyruvate isomerase (putative))	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Alliance orthologs ³
Rattus norvegicus (Norway rat):	Hyi (hydroxypyruvate isomerase)	Alliance	DIOPT (Ensembl Compara\|Hieranoid\|InParanoid\|OMA\|OrthoFinder\|OrthoInspector\|PANTHER\|PhylomeDB\|SonicParanoid)
Homo sapiens (human):	HYI (hydroxypyruvate isomerase (putative))	Alliance	DIOPT (Ensembl Compara\|HGNC\|Hieranoid\|InParanoid\|OMA\|OrthoFinder\|OrthoInspector\|PANTHER\|PhylomeDB\|SonicParanoid)
Danio rerio (zebrafish):	hyi (hydroxypyruvate isomerase)	Alliance	DIOPT (Ensembl Compara\|Hieranoid\|InParanoid\|OMA\|OrthoFinder\|OrthoInspector\|PANTHER\|PhylomeDB\|SonicParanoid\|ZFIN)
Caenorhabditis elegans (roundworm):	C05D11.5	Alliance	DIOPT (Ensembl Compara\|Hieranoid\|InParanoid\|OMA\|OrthoFinder\|OrthoInspector\|PANTHER\|PhylomeDB\|SonicParanoid)
Drosophila melanogaster (fruit fly):	Gip	Alliance	DIOPT (Ensembl Compara\|Hieranoid\|InParanoid\|OMA\|OrthoFinder\|OrthoInspector\|PANTHER\|PhylomeDB\|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):	hyi	Alliance	DIOPT (Ensembl Compara\|Hieranoid\|InParanoid\|OMA\|OrthoFinder\|OrthoInspector\|PANTHER\|PhylomeDB\|SonicParanoid)

Latest Assembly:

GRCm39 - Mouse Genome Assembly GRCm39

NCBI Annotation Information:

Note: Genetic polymorphisms result in both protein coding and non-coding alleles of this gene.

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	4	118,217,196 - 118,219,941 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	4	118,217,187 - 118,219,941 (+)	Ensembl		GRCm39 Ensembl
GRCm38	4	118,359,999 - 118,362,744 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	4	118,359,990 - 118,362,744 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	4	118,032,619 - 118,035,349 (+)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
MGSCv36	4	117,857,943 - 117,860,676 (+)	NCBI		MGSCv36	mm8
Celera	4	117,082,367 - 117,085,124 (+)	NCBI		Celera
Cytogenetic Map	4	D2.1	NCBI
cM Map	4	54.61	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Hyi	Mouse	Charcot-Marie-Tooth disease dominant intermediate C		ISO	HYI (Homo sapiens)	8554872	ClinVar Annotator: match by term: Charcot-Marie-Tooth disease dominant intermediate C	ClinVar	PMID:28492532
Hyi	Mouse	developmental and epileptic encephalopathy 18		ISO	HYI (Homo sapiens)	8554872	ClinVar Annotator: match by term: Developmental and epileptic encephalopathy and 18	ClinVar	PMID:25741868

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Hyi	Mouse	(+)-schisandrin B	multiple interactions	ISO	Hyi (Rattus norvegicus)	6480464	schizandrin B inhibits the reaction [Carbon Tetrachloride results in decreased expression of HYI mRNA]	CTD	PMID:31150632
Hyi	Mouse	17alpha-ethynylestradiol	affects expression	EXP		6480464	Ethinyl Estradiol affects the expression of HYI mRNA	CTD	PMID:17555576
Hyi	Mouse	17beta-estradiol	multiple interactions	ISO	HYI (Homo sapiens)	6480464	[Estradiol co-treated with TGFB1 protein] results in increased expression of HYI mRNA	CTD	PMID:30165855
Hyi	Mouse	2,3,7,8-tetrachlorodibenzodioxine	decreases expression	EXP		6480464	Tetrachlorodibenzodioxin results in decreased expression of HYI mRNA	CTD	PMID:19770486
Hyi	Mouse	2,3,7,8-tetrachlorodibenzodioxine	increases expression	ISO	Hyi (Rattus norvegicus)	6480464	Tetrachlorodibenzodioxin results in increased expression of HYI mRNA	CTD	PMID:33387578
Hyi	Mouse	2,3,7,8-tetrachlorodibenzodioxine	affects expression	EXP		6480464	Tetrachlorodibenzodioxin affects the expression of HYI mRNA	CTD	PMID:21570461 and PMID:26377647
Hyi	Mouse	6-propyl-2-thiouracil	increases expression	ISO	Hyi (Rattus norvegicus)	6480464	Propylthiouracil results in increased expression of HYI mRNA	CTD	PMID:24780913
Hyi	Mouse	acrylamide	decreases expression	ISO	Hyi (Rattus norvegicus)	6480464	Acrylamide results in decreased expression of HYI mRNA	CTD	PMID:28959563
Hyi	Mouse	antirheumatic drug	increases expression	ISO	HYI (Homo sapiens)	6480464	Antirheumatic Agents results in increased expression of HYI mRNA	CTD	PMID:24449571
Hyi	Mouse	arsane	multiple interactions	ISO	HYI (Homo sapiens)	6480464	[[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of HYI mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of HYI mRNA	CTD	PMID:39836092
Hyi	Mouse	arsenic atom	multiple interactions	ISO	HYI (Homo sapiens)	6480464	[[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of HYI mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of HYI mRNA	CTD	PMID:39836092
Hyi	Mouse	arsenite(3-)	increases methylation	ISO	HYI (Homo sapiens)	6480464	arsenite results in increased methylation of HYI promoter	CTD	PMID:23974009
Hyi	Mouse	belinostat	decreases expression	ISO	HYI (Homo sapiens)	6480464	belinostat results in decreased expression of HYI mRNA	CTD	PMID:27188386
Hyi	Mouse	benzo[a]pyrene	increases expression	EXP		6480464	Benzo(a)pyrene results in increased expression of HYI mRNA	CTD	PMID:22228805
Hyi	Mouse	benzo[a]pyrene	decreases methylation	ISO	HYI (Homo sapiens)	6480464	Benzo(a)pyrene results in decreased methylation of HYI promoter	CTD	PMID:27901495
Hyi	Mouse	bisphenol A	affects expression	ISO	Hyi (Rattus norvegicus)	6480464	bisphenol A affects the expression of HYI mRNA	CTD	PMID:25181051
Hyi	Mouse	butanal	increases expression	ISO	HYI (Homo sapiens)	6480464	butyraldehyde results in increased expression of HYI mRNA	CTD	PMID:26079696
Hyi	Mouse	cadmium atom	multiple interactions	EXP		6480464	[Tetradecanoylphorbol Acetate co-treated with [Cadmium Chloride results in increased abundance of Cadmium]] affects the expression of HYI mRNA	CTD	PMID:31904401
Hyi	Mouse	cadmium dichloride	multiple interactions	EXP		6480464	[Tetradecanoylphorbol Acetate co-treated with [Cadmium Chloride results in increased abundance of Cadmium]] affects the expression of HYI mRNA	CTD	PMID:31904401
Hyi	Mouse	carbon nanotube	decreases expression	EXP		6480464	Nanotubes more ...	CTD	PMID:25554681 and PMID:25620056
Hyi	Mouse	CGP 52608	multiple interactions	ISO	HYI (Homo sapiens)	6480464	CGP 52608 promotes the reaction [RORA protein binds to HYI gene]	CTD	PMID:28238834
Hyi	Mouse	choline	multiple interactions	EXP		6480464	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased methylation of HYI gene	CTD	PMID:20938992
Hyi	Mouse	clofibrate	decreases expression	EXP		6480464	Clofibrate results in decreased expression of HYI mRNA	CTD	PMID:23811191
Hyi	Mouse	cobalt dichloride	decreases expression	ISO	HYI (Homo sapiens)	6480464	cobaltous chloride results in decreased expression of HYI mRNA	CTD	PMID:19320972
Hyi	Mouse	cobalt dichloride	decreases expression	ISO	Hyi (Rattus norvegicus)	6480464	cobaltous chloride results in decreased expression of HYI mRNA	CTD	PMID:24386269
Hyi	Mouse	Cuprizon	increases expression	ISO	Hyi (Rattus norvegicus)	6480464	Cuprizone results in increased expression of HYI mRNA	CTD	PMID:26577399
Hyi	Mouse	cyclosporin A	decreases methylation	ISO	HYI (Homo sapiens)	6480464	Cyclosporine results in decreased methylation of HYI promoter	CTD	PMID:27989131
Hyi	Mouse	ethanol	affects expression	EXP		6480464	Ethanol affects the expression of HYI mRNA	CTD	PMID:30319688
Hyi	Mouse	fenthion	increases expression	EXP		6480464	Fenthion results in increased expression of HYI mRNA	CTD	PMID:34813904
Hyi	Mouse	folic acid	multiple interactions	EXP		6480464	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased methylation of HYI gene	CTD	PMID:20938992
Hyi	Mouse	genistein	decreases expression	ISO	HYI (Homo sapiens)	6480464	Genistein results in decreased expression of HYI mRNA	CTD	PMID:16705744
Hyi	Mouse	hydralazine	multiple interactions	ISO	HYI (Homo sapiens)	6480464	[Hydralazine co-treated with Valproic Acid] results in increased expression of HYI mRNA	CTD	PMID:17183730
Hyi	Mouse	indometacin	decreases expression	ISO	Hyi (Rattus norvegicus)	6480464	Indomethacin results in decreased expression of HYI mRNA	CTD	PMID:36868495
Hyi	Mouse	inulin	multiple interactions	EXP		6480464	[perfluorooctane sulfonic acid co-treated with Inulin] results in increased expression of HYI mRNA	CTD	PMID:36331819
Hyi	Mouse	L-methionine	multiple interactions	EXP		6480464	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased methylation of HYI gene	CTD	PMID:20938992
Hyi	Mouse	lead(0)	decreases expression	ISO	HYI (Homo sapiens)	6480464	Lead results in decreased expression of HYI mRNA	CTD	PMID:19921347
Hyi	Mouse	manganese atom	multiple interactions	ISO	HYI (Homo sapiens)	6480464	[[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of HYI mRNA	CTD	PMID:39836092
Hyi	Mouse	manganese(0)	multiple interactions	ISO	HYI (Homo sapiens)	6480464	[[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of HYI mRNA	CTD	PMID:39836092
Hyi	Mouse	manganese(II) chloride	multiple interactions	ISO	HYI (Homo sapiens)	6480464	[[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of HYI mRNA	CTD	PMID:39836092
Hyi	Mouse	nickel atom	decreases expression	ISO	HYI (Homo sapiens)	6480464	Nickel results in decreased expression of HYI mRNA	CTD	PMID:24768652 and PMID:25583101
Hyi	Mouse	ozone	multiple interactions	EXP		6480464	[Air Pollutants results in increased abundance of Ozone] which results in decreased expression of HYI mRNA	CTD	PMID:34911549
Hyi	Mouse	paracetamol	affects expression	EXP		6480464	Acetaminophen affects the expression of HYI mRNA	CTD	PMID:17562736
Hyi	Mouse	paracetamol	decreases expression	ISO	Hyi (Rattus norvegicus)	6480464	Acetaminophen results in decreased expression of HYI mRNA	CTD	PMID:33387578
Hyi	Mouse	perfluorooctane-1-sulfonic acid	multiple interactions	EXP		6480464	[perfluorooctane sulfonic acid co-treated with Inulin] results in increased expression of HYI mRNA and [perfluorooctane sulfonic acid co-treated with Pectins] results in increased expression of HYI mRNA	CTD	PMID:36331819
Hyi	Mouse	phenobarbital	affects expression	ISO	HYI (Homo sapiens)	6480464	Phenobarbital affects the expression of HYI mRNA	CTD	PMID:19159669
Hyi	Mouse	phorbol 13-acetate 12-myristate	multiple interactions	EXP		6480464	[Tetradecanoylphorbol Acetate co-treated with [Cadmium Chloride results in increased abundance of Cadmium]] affects the expression of HYI mRNA	CTD	PMID:31904401
Hyi	Mouse	pirinixic acid	increases expression	EXP		6480464	pirinixic acid results in increased expression of HYI mRNA	CTD	PMID:17426115
Hyi	Mouse	rotenone	increases expression	ISO	HYI (Homo sapiens)	6480464	Rotenone results in increased expression of HYI mRNA	CTD	PMID:29955902
Hyi	Mouse	silicon dioxide	increases expression	ISO	HYI (Homo sapiens)	6480464	Silicon Dioxide analog results in increased expression of HYI mRNA	CTD	PMID:25895662
Hyi	Mouse	sodium arsenite	decreases expression	EXP		6480464	sodium arsenite results in decreased expression of HYI mRNA	CTD	PMID:33145626 more ...
Hyi	Mouse	sodium arsenite	increases expression	EXP		6480464	sodium arsenite results in increased expression of HYI mRNA	CTD	PMID:33933676
Hyi	Mouse	sodium arsenite	multiple interactions	ISO	HYI (Homo sapiens)	6480464	[[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of HYI mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of HYI mRNA	CTD	PMID:39836092
Hyi	Mouse	sodium dichromate	affects expression	ISO	Hyi (Rattus norvegicus)	6480464	sodium bichromate affects the expression of HYI mRNA	CTD	PMID:22110744
Hyi	Mouse	sodium fluoride	decreases expression	EXP		6480464	Sodium Fluoride results in decreased expression of HYI protein	CTD	PMID:28918527
Hyi	Mouse	sunitinib	decreases expression	ISO	HYI (Homo sapiens)	6480464	Sunitinib results in decreased expression of HYI mRNA	CTD	PMID:31533062
Hyi	Mouse	T-2 toxin	increases expression	ISO	HYI (Homo sapiens)	6480464	T-2 Toxin results in increased expression of HYI mRNA	CTD	PMID:31863870
Hyi	Mouse	tamoxifen	affects expression	EXP		6480464	Tamoxifen affects the expression of HYI mRNA	CTD	PMID:17555576
Hyi	Mouse	tetrachloromethane	decreases expression	EXP		6480464	Carbon Tetrachloride results in decreased expression of HYI mRNA	CTD	PMID:27339419 and PMID:31919559
Hyi	Mouse	tetrachloromethane	multiple interactions	ISO	Hyi (Rattus norvegicus)	6480464	schizandrin B inhibits the reaction [Carbon Tetrachloride results in decreased expression of HYI mRNA]	CTD	PMID:31150632
Hyi	Mouse	tetrachloromethane	decreases expression	ISO	Hyi (Rattus norvegicus)	6480464	Carbon Tetrachloride results in decreased expression of HYI mRNA	CTD	PMID:31150632
Hyi	Mouse	thioacetamide	decreases expression	ISO	Hyi (Rattus norvegicus)	6480464	Thioacetamide results in decreased expression of HYI mRNA	CTD	PMID:34492290
Hyi	Mouse	trovafloxacin	decreases expression	EXP		6480464	trovafloxacin results in decreased expression of HYI mRNA	CTD	PMID:35537566
Hyi	Mouse	valproic acid	multiple interactions	ISO	HYI (Homo sapiens)	6480464	[Hydralazine co-treated with Valproic Acid] results in increased expression of HYI mRNA	CTD	PMID:17183730
Hyi	Mouse	valproic acid	decreases methylation	ISO	HYI (Homo sapiens)	6480464	Valproic Acid results in decreased methylation of HYI gene	CTD	PMID:29154799
Hyi	Mouse	valproic acid	affects expression	ISO	HYI (Homo sapiens)	6480464	Valproic Acid affects the expression of HYI mRNA	CTD	PMID:25979313
Hyi	Mouse	valproic acid	decreases expression	ISO	HYI (Homo sapiens)	6480464	Valproic Acid results in decreased expression of HYI mRNA	CTD	PMID:23179753 more ...
Hyi	Mouse	vorinostat	decreases expression	ISO	HYI (Homo sapiens)	6480464	vorinostat results in decreased expression of HYI mRNA	CTD	PMID:27188386

Biological Process

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Hyi	Mouse	glyoxylate metabolic process	involved_in	IBA	PANTHER:PTN001740130 and UniProtKB:P30147	2290270		GO_Central	GO_REF:0000033

Molecular Function

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Hyi	Mouse	hydroxypyruvate isomerase activity	enables	IEA	EC:5.3.1.22	2290270		UniProt	GO_REF:0000003
Hyi	Mouse	hydroxypyruvate isomerase activity	enables	IBA	PANTHER:PTN001740130 and UniProtKB:P30147	2290270		GO_Central	GO_REF:0000033
Hyi	Mouse	hydroxypyruvate isomerase activity	enables	IEA	RHEA:11952	2290270		RHEA	GO_REF:0000116
Hyi	Mouse	protein binding	enables	ISO	UniProtKB:O95865	9068941	PMID:33961781	IntAct	PMID:33961781
Hyi	Mouse	protein binding	enables	ISO	UniProtKB:Q05519 and UniProtKB:Q8IYF3	9068941	PMID:25416956	IntAct	PMID:25416956
Hyi	Mouse	protein binding	enables	ISO	UniProtKB:Q8IYF3	9068941	PMID:16189514	IntAct	PMID:16189514

Imported Annotations - KEGG (archival)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Hyi	Mouse	glyoxylate and dicarboxylate metabolic pathway		IEA		6907045		KEGG	mmu:00630

#	Reference Title	Reference Citation
1.	KEGG Annotation Import Pipeline	Pipeline to import KEGG annotations from KEGG into RGD
2.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions

PMID:8889548	PMID:10349636	PMID:11042159	PMID:11076861	PMID:11125038	PMID:11217851	PMID:12466851	PMID:12477932	PMID:14610273	PMID:14681479	PMID:16141072	PMID:16141073
PMID:19624305	PMID:21267068	PMID:21677750	PMID:21873635

Hyi
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	4	118,217,196 - 118,219,941 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	4	118,217,187 - 118,219,941 (+)	Ensembl		GRCm39 Ensembl
GRCm38	4	118,359,999 - 118,362,744 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	4	118,359,990 - 118,362,744 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	4	118,032,619 - 118,035,349 (+)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
MGSCv36	4	117,857,943 - 117,860,676 (+)	NCBI		MGSCv36	mm8
Celera	4	117,082,367 - 117,085,124 (+)	NCBI		Celera
Cytogenetic Map	4	D2.1	NCBI
cM Map	4	54.61	NCBI

HYI
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	1	43,450,607 - 43,453,931 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	1	43,450,989 - 43,453,989 (-)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	1	43,916,660 - 43,919,602 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	1	43,689,416 - 43,692,505 (-)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	1	42,199,021 - 42,201,719 (-)	NCBI		Celera
Cytogenetic Map	1	p34.2	NCBI
HuRef	1	42,035,819 - 42,038,805 (-)	NCBI		HuRef
CHM1_1	1	44,033,042 - 44,036,028 (-)	NCBI		CHM1_1
T2T-CHM13v2.0	1	43,320,860 - 43,324,184 (-)	NCBI		T2T-CHM13v2.0

Hyi
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	5	137,179,975 - 137,182,654 (+)	NCBI		GRCr8
mRatBN7.2	5	131,894,575 - 131,897,709 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	5	131,894,598 - 131,897,251 (+)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	5	134,602,204 - 134,604,882 (+)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	5	136,356,842 - 136,359,520 (+)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	5	136,379,245 - 136,381,923 (+)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	5	137,189,440 - 137,192,125 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	5	137,189,473 - 137,192,240 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	5	140,977,014 - 140,979,675 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
RGSC_v3.4	5	138,842,872 - 138,843,826 (+)	NCBI	RGSC3.4	RGSC_v3.4	rn4	RGSC3.4
Celera	5	130,440,056 - 130,442,740 (+)	NCBI		Celera
Cytogenetic Map	5	q36	NCBI

Hyi
(Chinchilla lanigera - long-tailed chinchilla)

Chinchilla Assembly	Chr	Position (strand)	Source	Genome Browsers
Chinchilla Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
ChiLan1.0 Ensembl	NW_004955537	3,017,940 - 3,020,513 (-)	Ensembl	ChiLan1.0
ChiLan1.0	NW_004955537	3,017,860 - 3,020,642 (-)	NCBI	ChiLan1.0	ChiLan1.0

HYI
(Pan paniscus - bonobo/pygmy chimpanzee)

Bonobo Assembly	Chr	Position (strand)	Source	Genome Browsers
Bonobo Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
NHGRI_mPanPan1-v2	1	183,355,884 - 183,358,887 (+)	NCBI		NHGRI_mPanPan1-v2
NHGRI_mPanPan1	1	182,497,179 - 182,500,813 (+)	NCBI		NHGRI_mPanPan1
Mhudiblu_PPA_v0	1	42,752,555 - 42,755,643 (-)	NCBI	Mhudiblu_PPA_v0	Mhudiblu_PPA_v0	panPan3
PanPan1.1	1	44,130,134 - 44,133,238 (-)	NCBI	panpan1.1	PanPan1.1	panPan2

HYI
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	15	16,726,441 - 16,729,070 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	15	16,726,274 - 16,729,062 (+)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	15	16,853,548 - 16,856,159 (+)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	15	16,893,249 - 16,895,860 (+)	NCBI		ROS_Cfam_1.0
UMICH_Zoey_3.1	15	16,685,953 - 16,688,564 (+)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	15	16,754,738 - 16,757,348 (+)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	15	16,828,302 - 16,830,913 (+)	NCBI		UU_Cfam_GSD_1.0

Hyi
(Ictidomys tridecemlineatus - thirteen-lined ground squirrel)

Squirrel Assembly	Chr	Position (strand)	Source	Genome Browsers
Squirrel Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
HiC_Itri_2	NW_024405058	59,012,684 - 59,015,032 (-)	NCBI		HiC_Itri_2
SpeTri2.0 Ensembl	NW_004936474	24,837,554 - 24,839,782 (-)	Ensembl	SpeTri2.0	SpeTri2.0 Ensembl
SpeTri2.0	NW_004936474	24,837,466 - 24,841,147 (-)	NCBI	SpeTri2.0	SpeTri2.0		SpeTri2.0

HYI
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	6	167,809,093 - 167,812,117 (+)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	6	167,809,063 - 167,811,588 (+)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	6	155,177,938 - 155,180,458 (+)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

HYI
(Chlorocebus sabaeus - green monkey)

Green Monkey Assembly	Chr	Position (strand)	Source	Genome Browsers
Green Monkey Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
ChlSab1.1	20	89,357,814 - 89,360,858 (+)	NCBI	ChlSab1.1	ChlSab1.1	chlSab2
ChlSab1.1 Ensembl	20	89,358,230 - 89,360,776 (+)	Ensembl	ChlSab1.1	ChlSab1.1 Ensembl	chlSab2
Vero_WHO_p1.0	NW_023666033	27,560,767 - 27,563,822 (-)	NCBI	Vero_WHO_p1.0	Vero_WHO_p1.0

Hyi
(Heterocephalus glaber - naked mole-rat)

Naked Mole-Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Naked Mole-Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
HetGla_female_1.0 Ensembl	NW_004624892	2,753,249 - 2,755,694 (-)	Ensembl	HetGla_female_1.0	HetGla_female_1.0 Ensembl	hetGla2
HetGla 1.0	NW_004624892	2,753,167 - 2,756,116 (-)	NCBI	HetGla_female_1.0	HetGla 1.0	hetGla2

Variants in Hyi
211 total Variants

Predicted Target Of

	Summary Value
Count of predictions:	1009
Count of miRNA genes:	441
Interacting mature miRNAs:	531
Transcripts:	ENSMUST00000006562, ENSMUST00000106393, ENSMUST00000132882, ENSMUST00000153202, ENSMUST00000179719
Prediction methods:	Miranda, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
12904006	Cfq1_m	conditioned fear QTL 1 (mouse)					4	117177646	120107755	Mouse
13824982	Svwq1_m	seminal vesicle weight QTL 1 (mouse)					4	89888237	118857197	Mouse
11532714	Sluc43_m	susceptibility to lung cancer 43 (mouse)					4	46642108	123127211	Mouse
10047132	Albq19_m	albuminuria QTL 19 (mouse)			Not determined		4	112824389	146824389	Mouse
12904002	Opfaq9_m	open field activity QTL 9 (mouse)					4	92975790	126975790	Mouse
14746982	Manh56_m	mandible shape 56 (mouse)					4	117815917	151815917	Mouse
4141623	W6q13_m	weight 6 weeks QTL 13 (mouse)			Not determined			88982069	140468203	Mouse
12910797	Pwgrq4_m	pre-weaning growth rate QTL 4 (mouse)					4	105835310	141433838	Mouse
25314312	Syncl2_m	synaptonemal complex length 2 (mouse)					4	65718237	146584457	Mouse
1357726	Lnopy1_m	lens opacity 1 (mouse)			Not determined		4	85428838	119429037	Mouse
12910794	Pwbwq8_m	post-weaning body weight QTL 8 (mouse)					4	105835310	141433838	Mouse
14696689	Gdq2_m	grooming duration QTL 2, females (mouse)					4	100857197	124893793	Mouse
1300743	Skull6_m	skull morphology 6 (mouse)			Not determined		4	111009051	145009280	Mouse
1301382	Arvm2_m	autoimmune renal vasculitis 2 (mouse)			Not determined		4	107791564	141791756	Mouse
12910813	Pwbwq4_m	pre-weaning body weight QTL 4 (mouse)					4	105835310	141433838	Mouse
4141093	W3q17_m	weight 3 weeks QTL 17 (mouse)			Not determined			88982069	140468203	Mouse
12910808	Pwbwq9_m	post-weaning body weight QTL 9 (mouse)					4	105835310	141433838	Mouse
27095939	Ulnl9_m	ulna length 9, 16 week (mouse)					4	65318237	118857197	Mouse
11567249	Elorr3_m	ethanol induced loss of righting response 3 (mouse)					4	3722677	156268235	Mouse
4142493	Femwf13_m	femur work to failure 13 (mouse)			Not determined			116154678	150154782	Mouse
1301815	Sles2_m	systemic lupus erythmatosus suppressor 2 (mouse)			Not determined		4	94957579	150676858	Mouse
1300663	Start2_m	startle response 2 (mouse)			Not determined		4	107264957	141265153	Mouse
1300918	Stheal4_m	soft tissue heal 4 (mouse)			Not determined		4	89969627	123969747	Mouse
1301556	Cd4vts1_m	CD4 virgin T cell subset 1 (mouse)			Not determined		4	85428838	119429037	Mouse
1301823	Bmd7_m	bone mineral density 7 (mouse)			Not determined		4	88982069	151654550	Mouse
4141330	Iva1_m	isovaleric acid smelling 1 (mouse)			Not determined			117071971	120723203	Mouse
1302078	Sluc21_m	susceptibility to lung cancer 21 (mouse)			Not determined		4	117401141	151401275	Mouse
10412072	Ssen1_m	suseptibility to Sendai virus 1 (mouse)			Not determined		4	109658132	133154782	Mouse
1301930	Papg1_m	pulmonary adenoma progression 1 (mouse)			Not determined		4	85781167	119781279	Mouse
13208562	Wght7_m	weight 7 (mouse)					4	90888237	148084457	Mouse
13208565	Bmiq6_m	body mass index QTL 6 (mouse)					4	110857197	125893793	Mouse
1300655	Nidds_m	non-insulin-dependent diabetes mellitus in SJL (mouse)			Not determined		4	115030777	129465915	Mouse
1300781	Lith8_m	lithogenic gene 8 (mouse)			Not determined		4	107264957	141265153	Mouse
39128212	Lwq21_m	liver weight QTL 21 (mouse)					4	88982069	140468203	Mouse
1300689	Dob1_m	Dietary obesity 1 (mouse)			Body weight		4	101574601	123127211	Mouse
27226716	Metcl2_m	metatarsal-calcaneal length 2, 5 week (mouse)					4	88118237	118557197	Mouse
1301847	Fecq2_m	fecundity QTL 2 (mouse)			Not determined		4	100071971	134072206	Mouse
26884445	Sklq7_m	skull length QTL 7, 10 week (mouse)					4	68018237	150884457	Mouse
1301597	Anxty_m	anxiety (mouse)			Not determined		4	74137574	128009280	Mouse
26884437	Sklq13_m	skull length QTL 13, 16 week (mouse)					4	57700000	155684457	Mouse
4141549	W10q10_m	weight 10 weeks QTL 10 (mouse)			Not determined			88982069	140468203	Mouse
1357895	Ctrcts_m	cataract severity (mouse)			Not determined		4	45709925	138342753	Mouse
1300809	Ccrs2_m	corpus callosum hemisphere surface size 2 (mouse)			Not determined		4	107264957	141265153	Mouse
1301106	Skts7_m	skin tumor susceptibility 7 (mouse)			Not determined		4	100071971	134072206	Mouse
1301233	Sbw2_m	splenomegaly-NZB x NZW 2 (mouse)			Not determined		4	94957579	128009280	Mouse
10755520	Rbc1_m	red blood cell count 1 (mouse)					4	108477692	142477692	Mouse
10755521	Hct1_m	hematocrit 1 (mouse)					4	108477692	142477692	Mouse
10755522	Hgb1_m	hemoglobin 1 (mouse)					4	108477692	142477692	Mouse
27095924	Pglq2_m	pelvic girdle length QTL 2, 5 week (mouse)					4	69118237	130727311	Mouse
1301118	Bbaa23_m	B.burgdorferi-associated arthritis 23 (mouse)			Not determined		4	85781167	119781279	Mouse
15039368	Nmrs19_m	NAFLD-associated magnetic resonance shift 19 (mouse)					4	90882780	124882780	Mouse
27095917	Scvln14_m	sacral vertebrae length 2, 16 week (mouse)					4	68018237	130277062	Mouse
1301731	Cafq2_m	caffeine metabolism QTL 2 (mouse)			Not determined		4	94732255	128732454	Mouse
4141900	Skts-fp1_m	skin tumor susceptibility in FVB and PWK 1 (mouse)			Not determined		4	53550839	124055180	Mouse
15039382	Ltgq7_m	liver triglyceride QTL 7 (mouse)					4	105705794	139705794	Mouse
15039377	Bw45_m	body weight QTL 45 (mouse)					4	105705794	139705794	Mouse
1300839	Dyscalc2_m	dystrophic cardiac calcinosis 2 (mouse)			Not determined		4	111009051	145009280	Mouse
12880433	Fgf23lq1_m	FGF23 serum level QTL 1 (mouse)					4	101157197	135157197	Mouse
4141001	Tgq17_m	triglyceride QTL 17 (mouse)			Not determined			112523489	146523489	Mouse
1300580	Lbw2_m	lupus NZB x NZW 2 (mouse)			Not determined		4	98545539	128009280	Mouse
15039378	Adip30_m	adiposity 30 (mouse)					4	105705794	139705794	Mouse
26884449	Sklq2_m	skull length QTL 2, 5 week (mouse)					4	36700000	128993793	Mouse
27095905	Scvln3_m	sacral vertebrae length 2, 5 week (mouse)					4	55600000	128993793	Mouse
1357800	Tgq3_m	triglyceride QTL 3 (mouse)			Not determined		4	107055093	141055180	Mouse
15039385	Mvlq3_m	macrovesicular liver lesion QTL 3 (mouse)					4	112182386	146182386	Mouse
11553870	Cmmm_m	carcinoma modifier of MSM (mouse)					4	90590668	124590781	Mouse
1301996	Mmtg2_m	modifier of mammary tumor growth 2 (mouse)			Not determined		4	116270979	124055180	Mouse

UniSTS:235003

Mouse Assembly	Chr	Position (strand)	Source	JBrowse
GRCm38	4	118,362,800 - 118,363,022	UniSTS	GRCm38
MGSCv37	4	118,035,405 - 118,035,627	UniSTS	GRCm37
Celera	4	117,085,180 - 117,085,402	UniSTS
Cytogenetic Map	4	D2.1	UniSTS

Click on a value in the shaded box below the category label to view a detailed expression data table for that system.


RefSeq Transcripts	NM_026601	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	NR_003946	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AA403499	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AK004328	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AK012313	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AK020099	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AK090361	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AL627212	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	BC024619	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	BC100401	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	BE996398	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	BX525112	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CB952524	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CH466552	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CK620463	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Ensembl Acc Id:

ENSMUST00000006562 ⟹ ENSMUSP00000006562

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39 Ensembl	4	118,217,211 - 118,219,941 (+)	Ensembl
GRCm38.p6 Ensembl	4	118,360,014 - 118,362,744 (+)	Ensembl

Ensembl Acc Id:

ENSMUST00000106393 ⟹ ENSMUSP00000102001

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39 Ensembl	4	118,217,196 - 118,219,941 (+)	Ensembl
GRCm38.p6 Ensembl	4	118,359,999 - 118,362,744 (+)	Ensembl

Ensembl Acc Id:

ENSMUST00000132882

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39 Ensembl	4	118,218,519 - 118,219,692 (+)	Ensembl
GRCm38.p6 Ensembl	4	118,361,322 - 118,362,495 (+)	Ensembl

Ensembl Acc Id:

ENSMUST00000179719

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39 Ensembl	4	118,217,196 - 118,218,491 (+)	Ensembl
GRCm38.p6 Ensembl	4	118,359,999 - 118,361,294 (+)	Ensembl

Ensembl Acc Id:

ENSMUST00000194248 ⟹ ENSMUSP00000141952

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39 Ensembl	4	118,217,187 - 118,219,941 (+)	Ensembl
GRCm38.p6 Ensembl	4	118,359,990 - 118,362,744 (+)	Ensembl

RefSeq Acc Id:

NR_003946

RefSeq Status:

VALIDATED

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39	4	118,217,196 - 118,219,941 (+)	NCBI
GRCm38	4	118,359,999 - 118,362,744 (+)	ENTREZGENE
MGSCv37	4	118,032,619 - 118,035,349 (+)	RGD
cM Map	4		ENTREZGENE

Sequence:

show sequence

CGAGGCCGCTCCCTCGCCGCCGCCTTCTGCTCGCATGGCTCCGCTCCGCTTTTCGGCCAACGTCTCCTGGCTGTTTCCAGAGCTCCCCGGGCTCCCCGAGCGGCTGCACGCCGCGGGCCGTGCGGGCT
TCGAAGCGGCCGAGGTGGCCTGGCCGTACACCGAGTCCCCCCAGGCGCTGGCGAGCGCGGCGCAGACTGCGGGACTGCGGCTGGTGCTCATCAACACGCCGCGGGGATCCACCTGATGGCTGGCCGAG
TACCCCAAGGGGCTGACCGGGCTGCAGTCAAGGGGGAGATGGAGACGGTTTTTGTGGAGAATCTGAAGCATGCAGCTGGCGTTCTGGCTCAGGAGAACCTCGTGGGACTGCTGGAGCCCATCAACACC
CGAATCACAGACCCCCAGTATTTCCTGGACACGCCCCGGCAAGCGGCAGCCATTTTGCAGAAGGTTGGGAGACCCAATCTGCAGTTGCAGATGGACATATTCCACTGGCAGATCATGGATGGGAATCT
CACAGGAAACATCAGGGAGTTTCTGCCCACTGTCGGGCATGTGCAAGTGGCCCAGGTCCCAGACCGCGGGGAGCCAGGCAGCTCTGGAGAGCTAGACTTTACTTACCTGTTTCAGCTGCTAGAAGATG
AGGGCTACCAAGGATTTGTGGGTTGCGAGTATCGGCCTCGAGGAGACACAGTGGAGGGTCTGAGTTGGCTACGTTCATACTGGGACAGGCGGGGCCACCCACGGACTGGCCAGTAAGGTTCTGCACAG
CACCTGCATGCTGCCCTGGGGCGGTGTGTTAGTGTCCGGAGTCCCCTCCTCTGAATTAAAATCACACTGAGCGTTAAAAAAAAAAAAAAAAAA

hide sequence


Protein RefSeqs	NP_080877	(Get FASTA)	NCBI Sequence Viewer
GenBank Protein	AAH24619	(Get FASTA)	NCBI Sequence Viewer
	AAI00402	(Get FASTA)	NCBI Sequence Viewer
	EDL30512	(Get FASTA)	NCBI Sequence Viewer
	EDL30513	(Get FASTA)	NCBI Sequence Viewer
	EDL30514	(Get FASTA)	NCBI Sequence Viewer
	EDL30515	(Get FASTA)	NCBI Sequence Viewer
	Q8R1F5	(Get FASTA)	NCBI Sequence Viewer

Ensembl Acc Id:

ENSMUSP00000006562 ⟸ ENSMUST00000006562

Ensembl Acc Id:

ENSMUSP00000102001 ⟸ ENSMUST00000106393

Ensembl Acc Id:

ENSMUSP00000141952 ⟸ ENSMUST00000194248

Name	Modeler	Protein Id	AA Range	Protein Structure
AF-Q8R1F5-F1-model_v2	AlphaFold	Q8R1F5	1-277	view protein structure

RGD ID:

6835486

Promoter ID:

MM_KWN:39286

Type:

CpG-Island

SO ACC ID:

SO:0000170

Source:

MPROMDB

Tissues & Cell Lines:

3T3L1_Day0, 3T3L1_Day1, 3T3L1_Day2, 3T3L1_Day3, 3T3L1_Day6, BoneMarrow_0Hour, BoneMarrow_2Hour, BoneMarrow_4Hour, Brain, ES_Cell, Kidney, Liver, Lung, MEF_B4, MEF_B6, Spleen

Transcripts:

ENSMUST00000106393, NM_026601, OTTMUST00000070777, UC008UJR.1

Position:

Mouse Assembly	Chr	Position (strand)	Source
MGSCv36	4	118,032,386 - 118,032,886 (+)	MPROMDB

RGD ID:

6835485

Promoter ID:

MM_KWN:39287

Type:

CpG-Island

SO ACC ID:

SO:0000170

Source:

MPROMDB

Tissues & Cell Lines:

Brain, Kidney, Lung, MEF_B4, MEF_B6

Transcripts:

OTTMUST00000070778

Position:

Mouse Assembly	Chr	Position (strand)	Source
MGSCv36	4	118,033,089 - 118,033,589 (+)	MPROMDB

RGD ID:

6884402

Promoter ID:

EPDNEW_M5652

Type:

initiation region

Name:

Hyi_1

Description:

Mus musculus hydroxypyruvate isomerase , transcript variant 1,mRNA.

SO ACC ID:

SO:0000170

Source:

EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)

Experiment Methods:

Single-end sequencing.

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38	4	118,360,009 - 118,360,069	EPDNEW

Database	Acc Id	Source(s)
Ensembl Genes	ENSMUSG00000006395	Ensembl, ENTREZGENE
Ensembl Transcript	ENSMUST00000106393	ENTREZGENE
Gene3D-CATH	Divalent-metal-dependent TIM barrel enzymes	UniProtKB/Swiss-Prot
InterPro	HyI-like	UniProtKB/Swiss-Prot
	Sugar_Epim/Isomerase	UniProtKB/Swiss-Prot
	Xyl_isomerase-like_sf	UniProtKB/Swiss-Prot
	Xyl_isomerase-like_TIM-brl	UniProtKB/Swiss-Prot
KEGG Report	mmu:68180	UniProtKB/Swiss-Prot
MGD	MGI:1915430	ENTREZGENE
NCBI Gene	68180	ENTREZGENE
PANTHER	HYDROXYPYRUVATE ISOMERASE-RELATED	UniProtKB/Swiss-Prot
	ISOMERASE	UniProtKB/Swiss-Prot
Pfam	AP_endonuc_2	UniProtKB/Swiss-Prot
PhenoGen	Hyi	PhenoGen
PIRSF	HyI	UniProtKB/Swiss-Prot
Superfamily-SCOP	SSF51658	UniProtKB/Swiss-Prot
UniProt	A2A9C1	ENTREZGENE
	HYI_MOUSE	UniProtKB/Swiss-Prot
	Q497S8	ENTREZGENE
	Q8R1F5	ENTREZGENE
	Z4YKI7_MOUSE	UniProtKB/TrEMBL
UniProt Secondary	A2A9C1	UniProtKB/Swiss-Prot
	Q497S8	UniProtKB/Swiss-Prot

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2015-12-29	Hyi	hydroxypyruvate isomerase (putative)		hydroxypyruvate isomerase homolog (E. coli)	Symbol and/or name change	5135510	APPROVED

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailable


InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailable


Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
		Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable

Send us a Message

Imported Disease Annotations - ClinVar

Imported Annotations - KEGG (archival)