Symbol:
Mir194-1
Name:
microRNA 194-1
RGD ID:
1608302
MGI Page
MGI
Description:
Acts upstream of or within cellular response to amino acid stimulus and cellular response to lipopolysaccharide. Part of RISC complex. Is expressed in several structures, including cranial ganglion; eye; gonad; hemolymphoid system gland; and inner ear. Orthologous to human MIR194-1 (microRNA 194-1).
Type:
ncrna (Ensembl: miRNA)
RefSeq Status:
PROVISIONAL
Previously known as:
miR-194; mir-194-1; Mirn; Mirn19; Mirn194; Mirn194-1
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 1 185,045,516 - 185,045,582 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 1 185,045,516 - 185,045,582 (+) Ensembl GRCm39 Ensembl GRCm38 1 185,313,319 - 185,313,385 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 1 185,313,319 - 185,313,385 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 1 187,137,198 - 187,137,264 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 Cytogenetic Map 1 H5 NCBI cM Map 1 89.49 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Mir194-1 (Mus musculus - house mouse)
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 1 185,045,516 - 185,045,582 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 1 185,045,516 - 185,045,582 (+) Ensembl GRCm39 Ensembl GRCm38 1 185,313,319 - 185,313,385 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 1 185,313,319 - 185,313,385 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 1 187,137,198 - 187,137,264 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 Cytogenetic Map 1 H5 NCBI cM Map 1 89.49 NCBI
MIR194-1 (Homo sapiens - human)
Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 1 220,118,157 - 220,118,241 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 1 220,118,157 - 220,118,241 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 1 220,291,499 - 220,291,583 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 1 218,358,121 - 218,358,205 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Celera 1 193,510,708 - 193,510,792 (-) NCBI Celera Cytogenetic Map 1 q41 NCBI HuRef 1 190,965,852 - 190,965,936 (-) NCBI HuRef CHM1_1 1 221,563,984 - 221,564,068 (-) NCBI CHM1_1 T2T-CHM13v2.0 1 219,357,431 - 219,357,515 (-) NCBI T2T-CHM13v2.0
Mir194-1 (Rattus norvegicus - Norway rat)
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 13 99,382,716 - 99,382,798 (+) NCBI GRCr8 mRatBN7.2 13 96,851,166 - 96,851,248 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 13 96,851,166 - 96,851,248 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 13 99,350,308 - 99,350,390 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 13 100,756,265 - 100,756,347 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 13 97,932,562 - 97,932,644 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 13 103,250,576 - 103,250,658 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 13 103,250,576 - 103,250,658 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 13 107,924,394 - 107,924,476 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 Celera 13 96,366,365 - 96,366,447 (+) NCBI Celera Cytogenetic Map 13 q26 NCBI
MIR194 (Canis lupus familiaris - dog)
Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 38 14,895,401 - 14,895,458 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 38 14,895,401 - 14,895,458 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 38 14,938,022 - 14,938,079 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 38 14,930,881 - 14,930,938 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 38 14,930,881 - 14,930,938 (-) Ensembl ROS_Cfam_1.0 Ensembl UNSW_CanFamBas_1.0 38 15,286,924 - 15,286,981 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 38 15,575,390 - 15,575,447 (-) NCBI UU_Cfam_GSD_1.0
MIR194B (Sus scrofa - pig)
Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 10 9,704,910 - 9,704,987 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 10 9,704,910 - 9,704,987 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 10 11,786,871 - 11,786,948 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
.
Predicted Targets
Count of predictions: 10594 Count of gene targets: 5479 Count of transcripts: 8529 Interacting mature miRNAs: mmu-miR-194-1-3p Prediction methods: Microtar, Miranda, Pita, Rnahybrid, Targetscan Result types: miRGate_prediction
11039528 Ccc3_m colitis susceptibility in the Collaborative Cross 3 (mouse) 1 3680142 195051546 Mouse 4141245 Cq2_m cholesterol QTL 2 (mouse) Not determined 1 157456299 191456436 Mouse 4141244 Bmd5c_m bone mineral density 5c (mouse) Not determined 155526796 189526897 Mouse 1558802 Skmw6_m skeletal muscle weight 6 (mouse) Not determined 1 167954584 195154279 Mouse 10412185 Hcs9_m hepatocarcinogenesis susceptibility 9 (mouse) Not determined 1 63854690 189303617 Mouse 13464138 Hdlq107_m HDL QTL 107 (mouse) 1 152132744 186132744 Mouse 1301652 Cpfd2_m cerebellum pattern fissures (mouse) Not determined 1 172303451 195154279 Mouse 12790987 Tgl5_m triglyceride 5 (mouse) 1 160097157 194097157 Mouse 4142389 Scfr1_m stem cell frequency regulator 1 (mouse) Not determined 171632048 189303617 Mouse 1300888 Berr1_m berghei resistance locus 1 (mouse) Not determined 1 164143227 190534272 Mouse 12790988 Phdlc5_m plasma HDL cholesterol 5 (mouse) 9 160097157 194097157 Mouse 1301251 Scc3_m colon tumor susceptibility 3 (mouse) Not determined 1 168213823 195154279 Mouse 1301122 Cd8mts1_m CD8 T memory cell subset 1 (mouse) Not determined 1 155831765 189831892 Mouse 1301632 Bw8q1_m body weight at 8 weeks QTL 1 (mouse) Not determined 1 161201261 195154279 Mouse 4141483 Femwf7_m femur work to failure 7 (mouse) Not determined 167462514 195154279 Mouse 1302023 Orch4_m autoimmune orchitis resistance 4 (mouse) Not determined 1 175211318 195154279 Mouse 1300745 Gvhd1_m graft-versus-host disease 1 (mouse) Not determined 1 157456299 191456436 Mouse 10412162 Nobq3_m New Zealand obese QTL 3 (mouse) Not determined 1 103933405 191225397 Mouse 1301134 Bmd1_m bone mineral density 1 (mouse) Not determined 1 156602037 189303617 Mouse 1302158 Fembrs5_m femur breaking strength 5 (mouse) Not determined 1 167462514 195154279 Mouse 1301132 Mors1_m modifier of obesity related sterility 1 (mouse) Not determined 1 170379500 195154279 Mouse 1357620 Aaj1_m anxiety in A/J 1 (mouse) Not determined 1 180832317 191851043 Mouse 1357493 Lgaq3_m late growth adjusted QTL 3 (mouse) Not determined 1 150193673 188359312 Mouse 11251722 Ewc1_m ethanol withdrawal and consumption 1 (mouse) 1 152132744 186132744 Mouse 10043963 Obq25_m obesity QTL 25 (mouse) Not determined 1 154410512 188410512 Mouse 1301431 Pcho1_m plasma cholesterol 1 (mouse) Not determined 1 159262573 193262693 Mouse 1357618 Splq5_m spleen weight QTL 5 (mouse) Not determined 1 150193673 188359312 Mouse 1301301 Sle1_m systemic lupus erythmatosus susceptibility 1 (mouse) Not determined 1 152038741 186038913 Mouse 12904936 Edlmmq1_m extensor digitorum longus muscle mass QTL 1 (mouse) 1 155002940 189002940 Mouse 1301565 Mnotch_m modifier of Notch (mouse) Not determined 1 157456299 191456436 Mouse 1301309 Emo1_m emotionality 1 (mouse) Not determined 1 162977097 185994196 Mouse 1357732 Tbbmd1_m total body bone mineral density 1 (mouse) Not determined 1 171983110 195154279 Mouse 1301025 Lbw7_m lupus NZB x NZW 7 (mouse) Not determined 1 152038741 186038913 Mouse 10412074 Nhdlt1_m non-HDL cholesterol and triglyceride levels 1 (mouse) Not determined 1 153675990 187676105 Mouse 12904944 Tammq1_m tibialis anterior muscle mass QTL 1 (mouse) 1 155002940 189002940 Mouse 1357485 Lgq4_m late growth QTL 4 (mouse) Not determined 1 150193673 188359312 Mouse 12904957 Gmmq1_m gastrocnemius muscle mass QTL 1 (mouse) 1 155002940 189002940 Mouse 11532690 Sluc37_m susceptibility to lung cancer 37 (mouse) 1 175468817 194111528 Mouse 1301932 Ssta2_m susceptibility to Salmonella typhimurium antigens 2 (mouse) Not determined 1 155716221 189716369 Mouse 1301202 Yaa4_m Y-linked autoimmune acceleration 4 (mouse) Not determined 1 158468817 192468938 Mouse 10054490 Opefa_m open field activity (mouse) Not determined 1 153712853 187712853 Mouse 1300823 Ath9_m atherosclerosis 9 (mouse) Not determined 1 160112768 194112883 Mouse 1301333 Mop3_m morphine preference 3 (mouse) Not determined 1 167756737 189303617 Mouse 1300948 Fglu2_m fasting glucose 2 (mouse) Not determined 1 157456299 191456436 Mouse 1301339 Hdlq15_m HDL QTL 15 (mouse) Not determined 1 165873675 195154279 Mouse 1301722 Cia9_m collagen induced arthritis QTL 9 (mouse) Not determined 1 45783900 189303617 Mouse 11059556 Lmr20b_m leishmaniasis resistance 20b (mouse) 1 158468817 192468938 Mouse 4141554 Cfmq1_m cystic fibrosis modifier QTL 1 (mouse) Not determined 1 152038741 186038913 Mouse 11059557 Lmr20a_m leishmaniasis resistance 20a (mouse) 1 158468817 192468938 Mouse 11059558 Lmr20c_m leishmaniasis resistance 20c (mouse) 1 158468817 192468938 Mouse 10043863 Swrl5_m SWR lupus locus 5 (mouse) Not determined 1 172303451 195154279 Mouse 1301596 Elnt_m escape latencies during navigation task (mouse) Not determined 1 162145207 194111528 Mouse 11049575 Lmr8b_m leishmaniasis resistance 8b (mouse) 1 172303451 195154279 Mouse 4141165 Bglu3_m blood glucose level 3 (mouse) Not determined 155831765 189831892 Mouse 12792983 Liq1_m limb inflammation QTL 1 (mouse) 1 167586086 191225397 Mouse 1357889 Lprq3_m lipoprotein QTL 3 (mouse) Not determined 1 152038741 186038913 Mouse 1301189 Lmr8_m leishmaniasis resistance 8 (mouse) Not determined 1 156602037 189303617 Mouse 4142182 Shali5_m survival time to hyperoxic acute lung injury 5 (mouse) Not determined 155582237 185994196 Mouse 10766456 Sle21_m systematic lupus erythematosus susceptibility 21 (mouse) 1 155831765 189831892 Mouse 10402498 Lmr20_m leishmaniasis resistance 20 (mouse) Not determined 1 158468817 192468938 Mouse 1301619 Cafq1_m caffeine metabolism QTL 1 (mouse) Not determined 1 155716221 189716369 Mouse 4141149 Hbnr4_m Heligmosomoides bakeri nematode resistance 4 (mouse) Not determined 147125258 188983224 Mouse 1300727 Mptp1_m MPTP sensitivity 1 (mouse) Not determined 1 171632048 192681050 Mouse 10054271 Nba9_m New Zealand Black autoimmunity 9 (mouse) Not determined 1 155525623 189527533 Mouse 11081167 Tir8_m trypanosome infection response 8 (mouse) 1 155716221 189716369 Mouse 10054270 Nba10_m New Zealand Black autoimmunity 10 (mouse) Not determined 1 152794822 186438620 Mouse 1302132 Pbw1_m pentobarbital withdrawal QTL 1 (mouse) Not determined 1 155831765 189831892 Mouse 1559024 Zit1_m zinc induced tolerance 1 (mouse) Not determined 1 167462514 195154279 Mouse 1357692 Axtq1_m anxiety QTL 1 (mouse) Not determined 1 180832317 191851043 Mouse 12880429 V25Dq1_m vitamin D inactive form serum level QTL 1 (mouse) 1 172632197 195154279 Mouse 12880426 V25Dq2_m vitamin D inactive form serum level QTL 2 (mouse) 1 172532197 195154279 Mouse 1300732 Melm2_m melanoma modifier 2 (mouse) Not determined 1 157456299 191456436 Mouse 4142159 Nba2_m New Zealand Black autoimmunity 2 (mouse) Not determined 151835111 185835280 Mouse 1301602 Bslm4_m basal locomotor activity 4 (mouse) Not determined 1 157456299 191456436 Mouse 1301216 Cbm1_m cerebellum weight 1 (mouse) Not determined 1 157456299 191456436 Mouse 1301866 Cplaq3_m circadian period of locomotor activity 3 (mouse) Not determined 1 155721528 189722608 Mouse 1300842 Sle9_m systematic lupus erythematosus susceptibility 9 (mouse) Not determined 1 158468817 192468938 Mouse 1300969 Sluc5_m susceptibility to lung cancer 5 (mouse) Not determined 1 151186243 185186402 Mouse 1301614 Cgnz1_m chronic glomerulonephritis in NZM 1 (mouse) Not determined 1 152038741 186038913 Mouse
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000083647
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 1 185,045,516 - 185,045,582 (+) Ensembl GRCm38.p6 Ensembl 1 185,313,319 - 185,313,385 (+) Ensembl
RefSeq Acc Id:
NR_029580
RefSeq Status:
PROVISIONAL
Type:
NON-CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 185,045,516 - 185,045,582 (+) NCBI GRCm38 1 185,313,319 - 185,313,385 (+) ENTREZGENE MGSCv37 1 187,137,198 - 187,137,264 (+) RGD cM Map 1 ENTREZGENE
Sequence:
ATCGGGTGTAACAGCAACTCCATGTGGACTGTGCTCGGATTCCAGTGGAGCTGCTGTTACTTCTGAT
hide sequence