Mir98 (microRNA 98) - Rat Genome Database

Name: Mir98
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

Advanced Search (OLGA)

Gene: Mir98 (microRNA 98) Mus musculus

Analyze

Symbol:

Mir98

Name:

microRNA 98

RGD ID:

1607576

MGI Page

MGI

Description:

Acts upstream of or within cellular response to lipopolysaccharide; long-term synaptic potentiation; and regulation of gene expression. Is expressed in lung and tooth. Orthologous to human MIR98 (microRNA 98).

Type:

ncrna (Ensembl: miRNA)

RefSeq Status:

PROVISIONAL

Previously known as:

Mir; mir-98; Mirn98; mmu-mir-; mmu-mir-98

RGD Orthologs

Alliance Orthologs

More Info

more info ...

Latest Assembly:

GRCm39 - Mouse Genome Assembly GRCm39

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	X	150,696,210 - 150,696,317 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	X	150,696,210 - 150,696,317 (+)	Ensembl		GRCm39 Ensembl
GRCm38	X	151,913,214 - 151,913,321 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	X	151,913,214 - 151,913,321 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	X	148,347,757 - 148,347,864 (+)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	X	132,517,150 - 132,517,257 (-)	NCBI		Celera
Cytogenetic Map	X	F3	NCBI
cM Map	X	68.46	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

Atkin Syndrome (ISO)

autistic disorder (ISO)

Colonic Neoplasms (ISO)

colorectal cancer (ISO)

congestive heart failure (ISO)

Cornelia de Lange syndrome 2 (ISO)

Esophageal Neoplasms (ISO)

Experimental Liver Neoplasms (ISO)

lung cancer (IEP)

Lung Neoplasms (ISO)

non-syndromic X-linked intellectual disability 1 (ISO)

ovarian carcinoma (ISO)

pre-malignant neoplasm (ISO)

syndromic X-linked intellectual disability Lubs type (ISO)

type 2 diabetes mellitus (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

(-)-epigallocatechin 3-gallate (ISO)

(S)-nicotine (EXP,ISO)

1,3,5-trinitro-1,3,5-triazinane (EXP,ISO)

17beta-hydroxy-5alpha-androstan-3-one (ISO)

2,3,7,8-tetrachlorodibenzodioxine (ISO)

2-hydroxypropanoic acid (ISO)

acrolein (ISO)

arsenous acid (ISO)

benzene (EXP)

benzo[a]pyrene (ISO)

bleomycin A2 (ISO)

cadmium atom (ISO)

cadmium dichloride (ISO)

chenodeoxycholic acid (ISO)

chloroform (EXP)

cisplatin (ISO)

dexamethasone (ISO)

diarsenic trioxide (ISO)

formaldehyde (ISO)

hydrogen peroxide (ISO)

lipopolysaccharide (EXP)

manganese(II) chloride (ISO)

mechlorethamine (ISO)

monocrotaline (EXP)

nicotine (EXP,ISO)

paracetamol (ISO)

paraquat (ISO)

quartz (ISO)

rac-lactic acid (ISO)

radon atom (ISO)

radon(0) (ISO)

resveratrol (ISO)

silicon dioxide (EXP)

sodium arsenite (EXP,ISO)

sodium fluoride (EXP)

streptozocin (EXP)

vinclozolin (ISO)

zinc atom (ISO)

zinc(0) (ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular response to amyloid-beta (ISO)

cellular response to lipopolysaccharide (IDA)

long-term synaptic potentiation (IEP)

miRNA-mediated gene silencing by inhibition of translation (ISO)

miRNA-mediated gene silencing by mRNA destabilization (ISO)

miRNA-mediated post-transcriptional gene silencing (ISO)

negative regulation of BMP signaling pathway (ISO)

negative regulation of cell population proliferation (ISO)

negative regulation of cholesterol biosynthetic process (ISO)

negative regulation of cytokine production (ISO)

negative regulation of cytokine production involved in inflammatory response (ISO)

negative regulation of extracellular matrix assembly (ISO)

negative regulation of extracellular matrix disassembly (ISO)

negative regulation of gene expression (ISO)

negative regulation of interleukin-1 beta production (ISO)

negative regulation of interleukin-10 production (IDA,ISO)

negative regulation of interleukin-6 production (ISO)

negative regulation of interleukin-6-mediated signaling pathway (ISO)

negative regulation of interleukin-8 production (ISO)

negative regulation of myofibroblast differentiation (ISO)

negative regulation of osteoblast differentiation (ISO)

negative regulation of transforming growth factor beta receptor signaling pathway (ISO)

negative regulation of tumor necrosis factor production (ISO)

negative regulation of vascular endothelial cell proliferation (ISO)

positive regulation of gene expression (IDA)

positive regulation of neuron apoptotic process (ISO)

regulation of cytokine production involved in inflammatory response (ISO)

Molecular Function

mRNA 3'-UTR binding (ISO)

mRNA base-pairing translational repressor activity (ISO)

References

References - curated

#	Reference Title	Reference Citation
1.	Circ_0048856 competes with ABCC1 for miR-193a-5p/miR-98-5p binding sites to promote the cisplatin resistance and tumorigenesis in lung cancer.	Liu L, etal., J Chemother. 2022 Mar 15:1-14. doi: 10.1080/1120009X.2022.2043515.
2.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions
3.	MicroRNA-31 activates the RAS pathway and functions as an oncogenic MicroRNA in human colorectal cancer by repressing RAS p21 GTPase activating protein 1 (RASA1).	Sun D, etal., J Biol Chem. 2013 Mar 29;288(13):9508-18. doi: 10.1074/jbc.M112.367763. Epub 2013 Jan 15.

Additional References at PubMed

PMID:16381832	PMID:17369397	PMID:17604727	PMID:18452032	PMID:19559694	PMID:20215419	PMID:20413612	PMID:20668074	PMID:21037258	PMID:21183740	PMID:21267068	PMID:21609717
PMID:22753148	PMID:23152446	PMID:23188821	PMID:24835278	PMID:25277211	PMID:25422988	PMID:25858512	PMID:26098770	PMID:26263183	PMID:28765925	PMID:29328483	PMID:29549823
PMID:30195495	PMID:30365070	PMID:30449595	PMID:30653268	PMID:31601141	PMID:32242402	PMID:32857843	PMID:32888161	PMID:34010470	PMID:34227845	PMID:34431160	PMID:34480014
PMID:34796378	PMID:37183710	PMID:37493583	PMID:38267060	PMID:38436805

Genomics

Comparative Map Data

Mir98
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	X	150,696,210 - 150,696,317 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	X	150,696,210 - 150,696,317 (+)	Ensembl		GRCm39 Ensembl
GRCm38	X	151,913,214 - 151,913,321 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	X	151,913,214 - 151,913,321 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	X	148,347,757 - 148,347,864 (+)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	X	132,517,150 - 132,517,257 (-)	NCBI		Celera
Cytogenetic Map	X	F3	NCBI
cM Map	X	68.46	NCBI

MIR98
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	X	53,556,223 - 53,556,341 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	X	53,556,223 - 53,556,341 (-)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	X	53,583,184 - 53,583,302 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	X	53,599,908 - 53,600,026 (-)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	X	57,414,753 - 57,414,871 (-)	NCBI		Celera
Cytogenetic Map	X	p11.22	NCBI
HuRef	X	50,639,144 - 50,639,262 (-)	NCBI		HuRef
CHM1_1	X	53,574,160 - 53,574,278 (-)	NCBI		CHM1_1
T2T-CHM13v2.0	X	52,842,581 - 52,842,699 (-)	NCBI		T2T-CHM13v2.0

Mir98
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	X	24,460,648 - 24,460,755 (+)	NCBI		GRCr8
mRatBN7.2	X	20,981,235 - 20,981,342 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	X	20,981,235 - 20,981,342 (+)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	X	18,458,905 - 18,459,012 (+)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	X	21,664,568 - 21,664,675 (-)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	X	21,546,878 - 21,546,985 (+)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	X	21,583,875 - 21,583,982 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	X	21,583,875 - 21,583,982 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	X	21,867,881 - 21,867,988 (-)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	X	21,262,415 - 21,262,522 (+)	NCBI		Celera
Cytogenetic Map	X	q13	NCBI

MIR98
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	X	45,253,693 - 45,253,772 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	X	45,253,696 - 45,253,775 (-)	Ensembl	CanFam3.1		canFam3	CanFam3.1
ROS_Cfam_1.0	X	45,578,696 - 45,578,775 (-)	NCBI		ROS_Cfam_1.0
UMICH_Zoey_3.1	X	45,073,740 - 45,073,819 (-)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	X	45,523,371 - 45,523,450 (-)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	X	45,590,976 - 45,591,055 (-)	NCBI		UU_Cfam_GSD_1.0

MIR98
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	X	46,302,381 - 46,302,460 (-)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	X	46,302,381 - 46,302,460 (-)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	X	51,800,864 - 51,800,943 (-)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

Variants

Variants in Mir98
4 total Variants

miRNA Target Status

Predicted Targets

	Summary Value
Count of predictions:	24017
Count of gene targets:	9813
Count of transcripts:	16226
Interacting mature miRNAs:	mmu-miR-98-3p, mmu-miR-98-5p
Prediction methods:	Microtar, Miranda, Pita, Pita,Targetscan, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

QTLs in Region (GRCm39)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
10401118	Pgia39_m	proteoglycan induced arthritis 39 (mouse)			Not determined		X	144474380	169476592	Mouse
1558900	Bw3_m	body weight QTL 3 (mouse)			Not determined		X	133540040	165298595	Mouse
1302000	Pgia25_m	proteoglycan induced arthritis 2 (mouse)			Not determined		X	144474380	169476592	Mouse
25314309	Syncl5_m	synaptonemal complex length 5 (mouse)					X	121909697	152582996	Mouse
13824981	Svwq2_m	seminal vesicle weight QTL 2 (mouse)					X	128900749	153782996	Mouse
12738421	Lfibq17_m	liver fibrosis QTL 17 (mouse)					X	148148453	164945064	Mouse
1301209	Cia19_m	collagen induced arthritis 19 (mouse)			Not determined		X	120993165	160213038	Mouse
10412164	Cmv2_m	cytomegalovirus resistance 2 (mouse)			Not determined		X	125685149	159685269	Mouse
1357823	Spha3_m	sperm head anomaly 3 (mouse)			Not determined		X	102055848	162758941	Mouse
1301276	Tswt_m	testis weight (mouse)			Not determined		X	138376411	150789338	Mouse

Expression

RNA-SEQ Expression

Click on a value in the shaded box below the category label to view a detailed expression data table for that system.

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_029753	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AL672180	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM608582	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Ensembl Acc Id:

ENSMUST00000083602

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39 Ensembl	X	150,696,210 - 150,696,317 (+)	Ensembl
GRCm38.p6 Ensembl	X	151,913,214 - 151,913,321 (+)	Ensembl

RefSeq Acc Id:

NR_029753

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39	X	150,696,210 - 150,696,317 (+)	NCBI
GRCm38	X	151,913,214 - 151,913,321 (+)	ENTREZGENE
MGSCv37	X	148,347,757 - 148,347,864 (+)	RGD
Celera	X	132,517,150 - 132,517,257 (-)	RGD
cM Map	X		ENTREZGENE

Sequence:

show sequence

CTGCACATGCTGGGGTGAGGTAGTAAGTTGTATTGTTGTGGGGTAGGGATTTTAGGCCCCAGTA
AGAAGATAACTATACAACTTACTACTTTCCTTGGTGTGTGGCAT

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	MGI:3619441	AgrOrtholog
Ensembl Genes	ENSMUSG00000065536	Ensembl, ENTREZGENE
Ensembl Transcript	ENSMUST00000083602	ENTREZGENE
MGD	MGI:3619441	ENTREZGENE
miRBase	MI0000586	ENTREZGENE
NCBI Gene	723947	ENTREZGENE
PhenoGen	Mir98	PhenoGen
RNAcentral	URS000025E0BB	RNACentral
	URS00004E0808	RNACentral
	URS000075B3FA	RNACentral

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD

Send us a Message

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD