Symbol:
TMEM109
Name:
transmembrane protein 109
RGD ID:
1601968
HGNC Page
HGNC:28771
Description:
Predicted to enable voltage-gated monoatomic cation channel activity. Acts upstream of or within cellular response to gamma radiation and negative regulation of programmed cell death. Located in extracellular exosome.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
hSND3; mg23; MGC5508; mitsugumin-23; SND3; SRP-independent targeting 3 homolog; voltage-gated monoatomic cation channel TMEM109
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Mus musculus (house mouse):
Tmem109 (transmembrane protein 109) HGNC
EggNOG, Ensembl, HGNC, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Rattus norvegicus (Norway rat):
Tmem109 (transmembrane protein 109) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Chinchilla lanigera (long-tailed chinchilla):
Tmem109 (transmembrane protein 109) NCBI
Ortholog
Pan paniscus (bonobo/pygmy chimpanzee):
TMEM109 (transmembrane protein 109) NCBI
Ortholog
Canis lupus familiaris (dog):
TMEM109 (transmembrane protein 109) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, Panther, Treefam
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Tmem109 (transmembrane protein 109) NCBI
Ortholog
Sus scrofa (pig):
TMEM109 (transmembrane protein 109) HGNC
EggNOG, Ensembl, NCBI, OMA, OrthoDB, Panther, Treefam
Chlorocebus sabaeus (green monkey):
TMEM109 (transmembrane protein 109) NCBI
Ortholog
Heterocephalus glaber (naked mole-rat):
Tmem109 (transmembrane protein 109) NCBI
Ortholog
Other homologs 2
Canis lupus familiaris (dog):
TMEM132A (transmembrane protein 132A) HGNC
EggNOG, OrthoDB
Rattus norvegicus (Norway rat):
Chrnb4 (cholinergic receptor nicotinic beta 4 subunit) HGNC
OMA
Alliance orthologs 3
Rattus norvegicus (Norway rat):
Tmem109 (transmembrane protein 109)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Tmem109 (transmembrane protein 109)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
si:dkey-9i23.15
Alliance
DIOPT (Ensembl Compara|OMA|OrthoFinder|PANTHER|PhylomeDB)
Allele / Splice:
See ClinVar data
Latest Assembly:
GRCh38 - Human Genome Assembly GRCh38
Position:
Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 11 60,914,158 - 60,923,443 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 11 60,913,907 - 60,923,443 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 11 60,681,630 - 60,690,915 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 11 60,438,253 - 60,447,491 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Celera 11 58,042,259 - 58,051,802 (+) NCBI Celera Cytogenetic Map 11 q12.2 NCBI HuRef 11 57,027,540 - 57,037,083 (+) NCBI HuRef CHM1_1 11 60,547,675 - 60,557,219 (+) NCBI CHM1_1 T2T-CHM13v2.0 11 60,865,308 - 60,874,594 (+) NCBI T2T-CHM13v2.0
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
TMEM109 Human 1,2-dimethylhydrazine multiple interactions ISO RGD:1616777 6480464 [1,2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of TMEM109 mRNA CTD PMID:22206623 TMEM109 Human 17alpha-ethynylestradiol affects expression ISO RGD:1616777 6480464 Ethinyl Estradiol affects the expression of TMEM109 mRNA CTD PMID:17555576 TMEM109 Human 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO RGD:1616777 6480464 Tetrachlorodibenzodioxin results in decreased expression of TMEM109 mRNA CTD PMID:19465110 TMEM109 Human 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO RGD:1359538 6480464 Tetrachlorodibenzodioxin results in increased expression of TMEM109 mRNA CTD PMID:32109520|PMID:33387578 TMEM109 Human 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO RGD:1616777 6480464 Tetrachlorodibenzodioxin affects the expression of TMEM109 mRNA CTD PMID:21570461|PMID:24680724 TMEM109 Human 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO RGD:1359538 6480464 Tetrachlorodibenzodioxin affects the expression of TMEM109 mRNA CTD PMID:22298810 TMEM109 Human 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO RGD:1359538 6480464 Tetrachlorodibenzodioxin results in decreased expression of TMEM109 mRNA CTD PMID:21215274 TMEM109 Human 2,6-dinitrotoluene affects expression ISO RGD:1359538 6480464 2,6-dinitrotoluene affects the expression of TMEM109 mRNA CTD PMID:21346803 TMEM109 Human 2-methylcholine affects expression EXP 6480464 beta-methylcholine affects the expression of TMEM109 mRNA CTD PMID:21179406 TMEM109 Human 3-isobutyl-1-methyl-7H-xanthine multiple interactions EXP 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] more ... CTD PMID:28628672 TMEM109 Human 4,4'-sulfonyldiphenol affects expression EXP 6480464 bisphenol S affects the expression of TMEM109 protein CTD PMID:31945527 TMEM109 Human 4,4'-sulfonyldiphenol increases expression EXP 6480464 bisphenol S results in increased expression of TMEM109 protein CTD PMID:34186270 TMEM109 Human aflatoxin B1 decreases methylation EXP 6480464 Aflatoxin B1 results in decreased methylation of TMEM109 gene CTD PMID:27153756 TMEM109 Human aristolochic acid A increases expression EXP 6480464 aristolochic acid I results in increased expression of TMEM109 mRNA CTD PMID:33212167 TMEM109 Human arsane multiple interactions EXP 6480464 [sodium arsenate results in increased abundance of Arsenic] which results in decreased expression of TMEM109 more ... CTD PMID:32525701 TMEM109 Human arsenic atom multiple interactions EXP 6480464 [sodium arsenate results in increased abundance of Arsenic] which results in decreased expression of TMEM109 more ... CTD PMID:32525701 TMEM109 Human arsenite(3-) increases expression ISO RGD:1616777 6480464 arsenite results in increased expression of TMEM109 protein CTD PMID:37955338 TMEM109 Human benzo[a]pyrene increases expression ISO RGD:1616777 6480464 Benzo(a)pyrene results in increased expression of TMEM109 mRNA CTD PMID:22228805 TMEM109 Human benzo[a]pyrene increases expression EXP 6480464 Benzo(a)pyrene results in increased expression of TMEM109 mRNA CTD PMID:32234424 TMEM109 Human benzo[a]pyrene affects methylation EXP 6480464 Benzo(a)pyrene affects the methylation of TMEM109 promoter CTD PMID:27901495 TMEM109 Human benzo[a]pyrene decreases methylation EXP 6480464 Benzo(a)pyrene results in decreased methylation of TMEM109 5' UTR CTD PMID:27901495 TMEM109 Human bis(2-chloroethyl) sulfide decreases expression EXP 6480464 Mustard Gas results in decreased expression of TMEM109 mRNA CTD PMID:25102026 TMEM109 Human bisphenol A increases expression ISO RGD:1359538 6480464 bisphenol A results in increased expression of TMEM109 mRNA CTD PMID:25181051 TMEM109 Human bisphenol A increases expression ISO RGD:1616777 6480464 bisphenol A results in increased expression of TMEM109 mRNA CTD PMID:33221593 TMEM109 Human bisphenol A increases methylation ISO RGD:1359538 6480464 bisphenol A results in increased methylation of TMEM109 gene CTD PMID:28505145 TMEM109 Human bisphenol AF increases expression EXP 6480464 bisphenol AF results in increased expression of TMEM109 protein CTD PMID:34186270 TMEM109 Human Bisphenol B increases expression EXP 6480464 bisphenol B results in increased expression of TMEM109 protein CTD PMID:34186270 TMEM109 Human bisphenol F multiple interactions EXP 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] more ... CTD PMID:28628672 TMEM109 Human bisphenol F increases expression ISO RGD:1616777 6480464 bisphenol F results in increased expression of TMEM109 mRNA CTD PMID:38685157 TMEM109 Human bisphenol F increases expression EXP 6480464 bisphenol F results in increased expression of TMEM109 protein CTD PMID:34186270 TMEM109 Human cadmium dichloride decreases expression EXP 6480464 Cadmium Chloride results in decreased expression of TMEM109 mRNA CTD PMID:38568856 TMEM109 Human captan decreases expression ISO RGD:1616777 6480464 Captan results in decreased expression of TMEM109 mRNA CTD PMID:31558096 TMEM109 Human carbon nanotube decreases expression ISO RGD:1616777 6480464 Nanotubes, Carbon analog results in decreased expression of TMEM109 mRNA; Nanotubes, Carbon results in decreased more ... CTD PMID:25554681 TMEM109 Human CGP 52608 multiple interactions EXP 6480464 CGP 52608 promotes the reaction [RORA protein binds to TMEM109 gene] CTD PMID:28238834 TMEM109 Human chlorpyrifos increases expression ISO RGD:1616777 6480464 Chlorpyrifos results in increased expression of TMEM109 mRNA CTD PMID:37019170 TMEM109 Human clobetasol increases expression ISO RGD:1616777 6480464 Clobetasol results in increased expression of TMEM109 mRNA CTD PMID:27462272 TMEM109 Human clozapine multiple interactions EXP 6480464 [Cuprizone co-treated with Clozapine] results in increased expression of TMEM109 protein CTD PMID:34122009 TMEM109 Human copper atom multiple interactions EXP 6480464 [NSC 689534 binds to Copper] which results in decreased expression of TMEM109 mRNA CTD PMID:20971185 TMEM109 Human copper(0) multiple interactions EXP 6480464 [NSC 689534 binds to Copper] which results in decreased expression of TMEM109 mRNA CTD PMID:20971185 TMEM109 Human Cuprizon multiple interactions EXP 6480464 [Cuprizone co-treated with Clozapine] results in increased expression of TMEM109 protein; [Cuprizone co-treated with Haloperidol] more ... CTD PMID:34122009 TMEM109 Human cyproconazole increases expression ISO RGD:1616777 6480464 cyproconazole results in increased expression of TMEM109 mRNA CTD PMID:22334560 TMEM109 Human dexamethasone multiple interactions EXP 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] more ... CTD PMID:28628672 TMEM109 Human dextran sulfate decreases expression ISO RGD:1616777 6480464 Dextran Sulfate results in decreased expression of TMEM109 protein CTD PMID:32272095 TMEM109 Human dextran sulfate multiple interactions ISO RGD:1616777 6480464 Erianin inhibits the reaction [Dextran Sulfate results in decreased expression of TMEM109 protein] CTD PMID:32272095 TMEM109 Human Dibutyl phosphate affects expression EXP 6480464 di-n-butylphosphoric acid affects the expression of TMEM109 mRNA CTD PMID:37042841 TMEM109 Human dioxygen decreases expression EXP 6480464 Oxygen deficiency results in decreased expression of TMEM109 mRNA CTD PMID:24236059 TMEM109 Human diuron decreases expression ISO RGD:1359538 6480464 Diuron results in decreased expression of TMEM109 mRNA CTD PMID:21551480 TMEM109 Human doxorubicin affects expression EXP 6480464 Doxorubicin affects the expression of TMEM109 protein CTD PMID:29385562 TMEM109 Human doxorubicin decreases expression EXP 6480464 Doxorubicin results in decreased expression of TMEM109 mRNA CTD PMID:29803840 TMEM109 Human epoxiconazole increases expression ISO RGD:1616777 6480464 epoxiconazole results in increased expression of TMEM109 mRNA CTD PMID:22334560 TMEM109 Human erianin multiple interactions ISO RGD:1616777 6480464 Erianin inhibits the reaction [Dextran Sulfate results in decreased expression of TMEM109 protein] CTD PMID:32272095 TMEM109 Human folic acid multiple interactions ISO RGD:1616777 6480464 [1,2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of TMEM109 mRNA CTD PMID:22206623 TMEM109 Human folpet decreases expression ISO RGD:1616777 6480464 folpet results in decreased expression of TMEM109 mRNA CTD PMID:31558096 TMEM109 Human furfural multiple interactions EXP 6480464 [Sodium Chloride co-treated with Furaldehyde] results in increased expression of TMEM109 protein CTD PMID:38598786 TMEM109 Human haloperidol multiple interactions EXP 6480464 [Cuprizone co-treated with Haloperidol] results in increased expression of TMEM109 protein CTD PMID:34122009 TMEM109 Human indometacin multiple interactions EXP 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] more ... CTD PMID:28628672 TMEM109 Human ivermectin decreases expression EXP 6480464 Ivermectin results in decreased expression of TMEM109 protein CTD PMID:32959892 TMEM109 Human nitrates multiple interactions ISO RGD:1616777 6480464 [Particulate Matter results in increased abundance of Nitrates] which results in increased expression of TMEM109 more ... CTD PMID:35964746 TMEM109 Human paracetamol decreases expression ISO RGD:1359538 6480464 Acetaminophen results in decreased expression of TMEM109 mRNA CTD PMID:33387578 TMEM109 Human pentachlorophenol increases expression ISO RGD:1616777 6480464 Pentachlorophenol results in increased expression of TMEM109 mRNA CTD PMID:23892564 TMEM109 Human pinostrobin increases expression EXP 6480464 pinostrobin results in increased expression of TMEM109 mRNA CTD PMID:37777166 TMEM109 Human propiconazole increases expression ISO RGD:1616777 6480464 propiconazole results in increased expression of TMEM109 mRNA CTD PMID:22334560 TMEM109 Human resveratrol increases expression ISO RGD:1616777 6480464 resveratrol results in increased expression of TMEM109 protein CTD PMID:25505154 TMEM109 Human sodium arsenate multiple interactions EXP 6480464 [sodium arsenate results in increased abundance of Arsenic] which results in decreased expression of TMEM109 more ... CTD PMID:32525701 TMEM109 Human sodium arsenite decreases expression EXP 6480464 sodium arsenite results in decreased expression of TMEM109 mRNA CTD PMID:38568856 TMEM109 Human sodium arsenite increases expression EXP 6480464 sodium arsenite results in increased expression of TMEM109 mRNA CTD PMID:34032870 TMEM109 Human sodium chloride multiple interactions EXP 6480464 [Sodium Chloride co-treated with Furaldehyde] results in increased expression of TMEM109 protein CTD PMID:38598786 TMEM109 Human sodium dichromate decreases expression ISO RGD:1616777 6480464 sodium bichromate results in decreased expression of TMEM109 mRNA CTD PMID:31558096 TMEM109 Human Soman decreases expression ISO RGD:1359538 6480464 Soman results in decreased expression of TMEM109 mRNA CTD PMID:19281266 TMEM109 Human tamoxifen affects expression ISO RGD:1616777 6480464 Tamoxifen affects the expression of TMEM109 mRNA CTD PMID:17555576 TMEM109 Human tetrachloromethane increases expression ISO RGD:1616777 6480464 Carbon Tetrachloride results in increased expression of TMEM109 mRNA CTD PMID:31919559 TMEM109 Human thioacetamide increases expression ISO RGD:1359538 6480464 Thioacetamide results in increased expression of TMEM109 mRNA CTD PMID:34492290 TMEM109 Human thiram decreases expression EXP 6480464 Thiram results in decreased expression of TMEM109 mRNA CTD PMID:38568856 TMEM109 Human titanium dioxide decreases expression ISO RGD:1616777 6480464 titanium dioxide results in decreased expression of TMEM109 mRNA CTD PMID:27760801 TMEM109 Human valproic acid affects expression EXP 6480464 Valproic Acid affects the expression of TMEM109 mRNA CTD PMID:25979313 TMEM109 Human vinclozolin increases expression ISO RGD:1359538 6480464 vinclozolin results in increased expression of TMEM109 mRNA CTD PMID:23034163
TMEM109 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 11 60,914,158 - 60,923,443 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 11 60,913,907 - 60,923,443 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 11 60,681,630 - 60,690,915 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 11 60,438,253 - 60,447,491 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Celera 11 58,042,259 - 58,051,802 (+) NCBI Celera Cytogenetic Map 11 q12.2 NCBI HuRef 11 57,027,540 - 57,037,083 (+) NCBI HuRef CHM1_1 11 60,547,675 - 60,557,219 (+) NCBI CHM1_1 T2T-CHM13v2.0 11 60,865,308 - 60,874,594 (+) NCBI T2T-CHM13v2.0
Tmem109 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 19 10,848,021 - 10,859,107 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 19 10,848,024 - 10,859,365 (-) Ensembl GRCm39 Ensembl GRCm38 19 10,870,657 - 10,881,743 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 19 10,870,660 - 10,882,001 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 19 10,945,150 - 10,956,233 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 19 10,937,705 - 10,948,788 (-) NCBI MGSCv36 mm8 Celera 19 11,563,729 - 11,574,942 (-) NCBI Celera Cytogenetic Map 19 A NCBI cM Map 19 7.29 NCBI
Tmem109 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 216,944,516 - 216,955,091 (-) NCBI GRCr8 mRatBN7.2 1 207,519,628 - 207,530,245 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 207,519,624 - 207,530,215 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 215,894,466 - 215,905,041 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 222,955,182 - 222,965,747 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 215,648,854 - 215,659,431 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 226,925,114 - 226,935,710 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 226,925,117 - 226,935,689 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 233,990,663 - 234,001,279 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 1 213,368,573 - 213,379,148 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 1 213,527,004 - 213,537,578 (-) NCBI Celera 1 205,012,212 - 205,022,789 (-) NCBI Celera Cytogenetic Map 1 q43 NCBI
Tmem109 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955511 5,562,206 - 5,565,267 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955511 5,557,322 - 5,564,866 (+) NCBI ChiLan1.0 ChiLan1.0
TMEM109 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 9 62,083,184 - 62,092,709 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 11 63,127,455 - 63,136,746 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 11 56,177,335 - 56,186,645 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 11 59,617,802 - 59,627,349 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 11 59,617,802 - 59,627,349 (+) Ensembl panpan1.1 panPan2
TMEM109 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 18 55,377,331 - 55,389,810 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 18 55,363,698 - 55,385,587 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 18 53,950,499 - 53,963,229 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 18 56,425,747 - 56,438,173 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 18 56,425,747 - 56,434,036 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 18 55,483,265 - 55,495,701 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 18 55,104,766 - 55,117,373 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 18 55,985,877 - 55,998,618 (-) NCBI UU_Cfam_GSD_1.0
Tmem109 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024404947 11,895,525 - 11,912,018 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936581 2,009,162 - 2,019,426 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936581 2,009,357 - 2,019,381 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
TMEM109 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 2 10,828,652 - 10,837,062 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 2 10,828,644 - 10,837,124 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 2 10,372,979 - 10,382,064 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
TMEM109 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 1 12,924,736 - 12,934,755 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 1 12,924,606 - 12,934,810 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666038 110,293,096 - 110,302,880 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Tmem109
.
Predicted Target Of
Count of predictions: 1825 Count of miRNA genes: 657 Interacting mature miRNAs: 770 Transcripts: ENST00000227525, ENST00000536171, ENST00000540280 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
407298948 GWAS947924_H blood protein measurement QTL GWAS947924 (human) 5e-113 blood protein amount (VT:0005416) blood protein measurement (CMO:0000028) 11 60921973 60921974 Human 597301327 GWAS1397401_H transmembrane protein 132A measurement QTL GWAS1397401 (human) 3e-92 transmembrane protein 132A measurement 11 60921973 60921974 Human 597123611 GWAS1219685_H blood protein measurement QTL GWAS1219685 (human) 2e-199 blood protein amount (VT:0005416) blood protein measurement (CMO:0000028) 11 60921973 60921974 Human 597177814 GWAS1273888_H transmembrane protein 132A measurement QTL GWAS1273888 (human) 2e-477 transmembrane protein 132A measurement 11 60921973 60921974 Human
WI-12296
Human Assembly Chr Position (strand) Source JBrowse GRCh37 11 60,690,710 - 60,690,859 UniSTS GRCh37 Build 36 11 60,447,286 - 60,447,435 RGD NCBI36 Celera 11 58,051,597 - 58,051,746 RGD Cytogenetic Map 11 q12.2 UniSTS HuRef 11 57,036,878 - 57,037,027 UniSTS GeneMap99-GB4 RH Map 11 227.83 UniSTS Whitehead-RH Map 11 289.1 UniSTS NCBI RH Map 11 557.1 UniSTS
RH11560
Human Assembly Chr Position (strand) Source JBrowse GRCh37 11 60,689,746 - 60,689,853 UniSTS GRCh37 Build 36 11 60,446,322 - 60,446,429 RGD NCBI36 Celera 11 58,050,633 - 58,050,740 RGD Cytogenetic Map 11 q12.2 UniSTS HuRef 11 57,035,914 - 57,036,021 UniSTS GeneMap99-GB4 RH Map 11 227.42 UniSTS NCBI RH Map 11 496.8 UniSTS
RH121096
Human Assembly Chr Position (strand) Source JBrowse GRCh37 11 60,687,212 - 60,687,536 UniSTS GRCh37 Build 36 11 60,443,788 - 60,444,112 RGD NCBI36 Celera 11 58,048,099 - 58,048,423 RGD Cytogenetic Map 11 q12.2 UniSTS HuRef 11 57,033,380 - 57,033,704 UniSTS TNG Radiation Hybrid Map 11 26705.0 UniSTS
D11S2290E
Human Assembly Chr Position (strand) Source JBrowse GRCh37 11 60,690,637 - 60,690,755 UniSTS GRCh37 Build 36 11 60,447,213 - 60,447,331 RGD NCBI36 Celera 11 58,051,524 - 58,051,642 RGD Cytogenetic Map 11 q12.2 UniSTS HuRef 11 57,036,805 - 57,036,923 UniSTS GeneMap99-GB4 RH Map 11 227.73 UniSTS
G30169
Human Assembly Chr Position (strand) Source JBrowse GRCh37 11 60,689,660 - 60,689,785 UniSTS GRCh37 Build 36 11 60,446,236 - 60,446,361 RGD NCBI36 Celera 11 58,050,547 - 58,050,672 RGD Cytogenetic Map 11 q12.2 UniSTS HuRef 11 57,035,828 - 57,035,953 UniSTS
D11S2248E
Human Assembly Chr Position (strand) Source JBrowse GRCh37 11 60,689,748 - 60,689,852 UniSTS GRCh37 Build 36 11 60,446,324 - 60,446,428 RGD NCBI36 Celera 11 58,050,635 - 58,050,739 RGD Cytogenetic Map 11 q12.2 UniSTS HuRef 11 57,035,916 - 57,036,020 UniSTS GeneMap99-GB4 RH Map 11 227.83 UniSTS NCBI RH Map 11 557.1 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
entire extraembryonic component
1204
2438
2788
2253
4965
1725
2351
5
624
1951
465
2268
7305
6471
53
3727
1
852
1744
1617
175
1
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENST00000227525 ⟹ ENSP00000227525
Type:
CODING
Position:
Human Assembly Chr Position (strand) Source GRCh38.p14 Ensembl 11 60,914,158 - 60,923,443 (+) Ensembl
Ensembl Acc Id:
ENST00000536171 ⟹ ENSP00000443990
Type:
CODING
Position:
Human Assembly Chr Position (strand) Source GRCh38.p14 Ensembl 11 60,919,678 - 60,923,376 (+) Ensembl
Ensembl Acc Id:
ENST00000540280
Type:
CODING
Position:
Human Assembly Chr Position (strand) Source GRCh38.p14 Ensembl 11 60,922,618 - 60,923,443 (+) Ensembl
Ensembl Acc Id:
ENST00000715796 ⟹ ENSP00000520520
Type:
CODING
Position:
Human Assembly Chr Position (strand) Source GRCh38.p14 Ensembl 11 60,913,907 - 60,923,443 (+) Ensembl
RefSeq Acc Id:
NM_024092 ⟹ NP_076997
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Human Assembly Chr Position (strand) Source GRCh38 11 60,914,158 - 60,923,443 (+) NCBI GRCh37 11 60,681,351 - 60,690,915 (+) NCBI Build 36 11 60,438,253 - 60,447,491 (+) NCBI Archive Celera 11 58,042,259 - 58,051,802 (+) RGD HuRef 11 57,027,540 - 57,037,083 (+) RGD CHM1_1 11 60,547,675 - 60,557,219 (+) NCBI T2T-CHM13v2.0 11 60,865,308 - 60,874,594 (+) NCBI
Sequence:
ATCCCGCCTTGCGCATGCGGAGAAGGTAAACCAGCGCCCCGAGTTGAGGCGCGGGTTTGGTGGCGCGTTTCAGCGAAGTCGCACGTGAAGGATAGCAGTGGCCTGAGAAAGACCCAGTCATGGCAGCC
hide sequence
RefSeq Acc Id:
NP_076997 ⟸ NM_024092
- Peptide Label:
precursor
- UniProtKB:
Q9BVC6 (UniProtKB/Swiss-Prot), B2R9T9 (UniProtKB/TrEMBL)
- Sequence:
MAASSISSPWGKHVFKAILMVLVALILLHSALAQSRRDFAPPGQQKREAPVDVLTQIGRSVRGTLDAWIGPETMHLVSESSSQVLWAISSAISVAFFALSGIAAQLLNALGLAGDYLAQGLKLSPGQV
hide sequence
Ensembl Acc Id:
ENSP00000227525 ⟸ ENST00000227525
Ensembl Acc Id:
ENSP00000443990 ⟸ ENST00000536171
Ensembl Acc Id:
ENSP00000520520 ⟸ ENST00000715796
RGD ID: 6789435 Promoter ID: HG_KWN:13031 Type: CpG-Island SO ACC ID: SO:0000170 Source: MPROMDB Tissues & Cell Lines: CD4+TCell, CD4+TCell_12Hour, HeLa_S3, Jurkat, K562, Lymphoblastoid, NB4 Transcripts: UC001NQG.1 Position: Human Assembly Chr Position (strand) Source Build 36 11 60,437,854 - 60,438,354 (+) MPROMDB
RGD ID: 6789436 Promoter ID: HG_KWN:13032 Type: Non-CpG SO ACC ID: SO:0000170 Source: MPROMDB Tissues & Cell Lines: CD4+TCell_12Hour Transcripts: UC001NQH.1 Position: Human Assembly Chr Position (strand) Source Build 36 11 60,443,576 - 60,444,076 (+) MPROMDB
RGD ID: 7220499 Promoter ID: EPDNEW_H15995 Type: initiation region Name: TMEM109_2 Description: transmembrane protein 109 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Alternative Promoters: null; see alsoEPDNEW_H15996 Experiment Methods: Single-end sequencing. Position: Human Assembly Chr Position (strand) Source GRCh38 11 60,913,953 - 60,914,013 EPDNEW
RGD ID: 7220501 Promoter ID: EPDNEW_H15996 Type: initiation region Name: TMEM109_1 Description: transmembrane protein 109 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Alternative Promoters: null; see alsoEPDNEW_H15995 Experiment Methods: Single-end sequencing. Position: Human Assembly Chr Position (strand) Source GRCh38 11 60,914,176 - 60,914,236 EPDNEW
