Symbol:
Ccl9
Name:
C-C motif chemokine ligand 9
RGD ID:
1321540
MGI Page
MGI
Description:
Predicted to enable CCR1 chemokine receptor binding activity; chemoattractant activity; and chemokine activity. Acts upstream of or within negative regulation of myoblast differentiation. Predicted to be active in extracellular space. Is expressed in several structures, including alimentary system; brain; eye; genitourinary system; and limb. Orthologous to human CCL15 (C-C motif chemokine ligand 15) and CCL23 (C-C motif chemokine ligand 23).
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
C-C motif chemokine 9; CCF18; chemokine (C-C motif) ligand 9; macrophage inflammatory protein 1-gamma; macrophage inflammatory protein-related protein 2; MIP-1 gamma; MIP-1-gamma; MRP; MRP-2; Scy; Scya; Scya10; Scya9; small inducible cytokine A10; small inducible cytokine A9; small-inducible cytokine A9
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
CCL23 (C-C motif chemokine ligand 23) HGNC
Ensembl, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB
Pan paniscus (bonobo/pygmy chimpanzee):
CCL23 (C-C motif chemokine ligand 23) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Other homologs 2
Homo sapiens (human):
CCL15 (C-C motif chemokine ligand 15) HGNC
EggNOG, Ensembl, Panther, PhylomeDB
Alliance orthologs 3
Rattus norvegicus (Norway rat):
Ccl9 (C-C motif chemokine ligand 9)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Homo sapiens (human):
CCL15 (C-C motif chemokine ligand 15)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Homo sapiens (human):
CCL23 (C-C motif chemokine ligand 23)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
ccl35.1 (chemokine (C-C motif) ligand 35, duplicate 1)
Alliance
DIOPT (Ensembl Compara|Hieranoid|PANTHER)
Danio rerio (zebrafish):
ccl35.2 (chemokine (C-C motif) ligand 35, duplicate 2)
Alliance
DIOPT (Ensembl Compara|Hieranoid|PANTHER)
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 11 83,463,743 - 83,469,462 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 11 83,463,745 - 83,469,462 (-) Ensembl GRCm39 Ensembl GRCm38 11 83,572,917 - 83,578,636 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 11 83,572,919 - 83,578,636 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 11 83,386,419 - 83,392,138 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 11 83,389,112 - 83,394,831 (-) NCBI MGSCv36 mm8 Celera 11 93,174,716 - 93,180,435 (-) NCBI Celera Cytogenetic Map 11 C NCBI cM Map 11 50.81 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Ccl9 Mouse (1->4)-beta-D-glucan multiple interactions EXP 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in increased expression of CCL9 mRNA CTD PMID:36331819 Ccl9 Mouse 1,1-dichloroethene increases expression EXP 6480464 vinylidene chloride results in increased expression of CCL9 mRNA CTD PMID:26682919 Ccl9 Mouse 1,2-dimethylhydrazine decreases expression EXP 6480464 1 and 2-Dimethylhydrazine results in decreased expression of CCL9 mRNA CTD PMID:22206623 Ccl9 Mouse 1,2-dimethylhydrazine multiple interactions EXP 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of CCL9 mRNA CTD PMID:22206623 Ccl9 Mouse 1-chloro-2,4-dinitrobenzene increases expression EXP 6480464 Dinitrochlorobenzene results in increased expression of CCL9 mRNA CTD PMID:19647056 and PMID:21404309 Ccl9 Mouse 17beta-estradiol increases expression EXP 6480464 Estradiol results in increased expression of CCL9 mRNA CTD PMID:19484750 Ccl9 Mouse 17beta-estradiol decreases expression EXP 6480464 Estradiol results in decreased expression of CCL9 mRNA CTD PMID:39298647 Ccl9 Mouse 2,2',4,4'-Tetrabromodiphenyl ether multiple interactions EXP 6480464 [Flame Retardants results in increased abundance of 2 more ... CTD PMID:38995820 Ccl9 Mouse 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of CCL9 mRNA CTD PMID:16114106 Ccl9 Mouse 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of CCL9 mRNA CTD PMID:26377647 Ccl9 Mouse 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of CCL9 mRNA CTD PMID:15667827 and PMID:19770486 Ccl9 Mouse 2,4,6-trinitrobenzenesulfonic acid increases expression EXP 6480464 Trinitrobenzenesulfonic Acid results in increased expression of CCL9 mRNA CTD PMID:17982090 Ccl9 Mouse 2,4-dibromophenyl 2,4,5-tribromophenyl ether affects expression EXP 6480464 2 more ... CTD PMID:38648751 Ccl9 Mouse 3-isobutyl-1-methyl-7H-xanthine multiple interactions EXP 6480464 [Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in decreased expression of CCL9 mRNA and TNF protein promotes the reaction [[Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in decreased expression of CCL9 mRNA] CTD PMID:23503329 Ccl9 Mouse 3-methylcholanthrene multiple interactions EXP 6480464 [Methylcholanthrene co-treated with Tetradecanoylphorbol Acetate] results in decreased expression of CCL9 mRNA CTD PMID:23519560 Ccl9 Mouse 4,4'-diaminodiphenylmethane increases expression EXP 6480464 4 and 4'-diaminodiphenylmethane results in increased expression of CCL9 mRNA CTD PMID:18648102 Ccl9 Mouse 4,4'-sulfonyldiphenol decreases expression EXP 6480464 bisphenol S results in decreased expression of CCL9 mRNA CTD PMID:39298647 Ccl9 Mouse 4,4'-sulfonyldiphenol increases expression EXP 6480464 bisphenol S results in increased expression of CCL9 mRNA CTD PMID:37611474 Ccl9 Mouse 4-(ethoxymethylene)-2-phenyloxazol-5-one increases expression EXP 6480464 Oxazolone results in increased expression of CCL9 mRNA CTD PMID:19647056 and PMID:21404309 Ccl9 Mouse aflatoxin B1 decreases expression EXP 6480464 Aflatoxin B1 results in decreased expression of CCL9 mRNA CTD PMID:19770486 Ccl9 Mouse aldehydo-D-glucose multiple interactions EXP 6480464 [lard co-treated with Cholesterol and Dietary co-treated with Dietary Sucrose co-treated with Fructose co-treated with Glucose] results in increased expression of CCL9 mRNA CTD PMID:37567420 Ccl9 Mouse all-trans-retinoic acid increases expression ISO CCL23 (Homo sapiens) 6480464 Tretinoin results in increased expression of CCL23 mRNA CTD PMID:33167477 Ccl9 Mouse alpha-amanitin affects expression EXP 6480464 Alpha-Amanitin affects the expression of CCL9 mRNA CTD PMID:38531469 Ccl9 Mouse antirheumatic drug decreases expression ISO CCL23 (Homo sapiens) 6480464 Antirheumatic Agents results in decreased expression of CCL23 mRNA CTD PMID:24449571 Ccl9 Mouse arsenous acid increases expression ISO CCL23 (Homo sapiens) 6480464 Arsenic Trioxide results in increased expression of CCL23 mRNA CTD PMID:15761015 Ccl9 Mouse Azoxymethane multiple interactions EXP 6480464 [titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in decreased expression of CCL9 mRNA CTD PMID:29950665 Ccl9 Mouse benzo[a]pyrene decreases expression EXP 6480464 Benzo(a)pyrene results in decreased expression of CCL9 mRNA CTD PMID:19770486 and PMID:20713471 Ccl9 Mouse benzo[a]pyrene increases methylation ISO CCL23 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of CCL23 exon CTD PMID:27901495 Ccl9 Mouse benzo[a]pyrene affects methylation ISO CCL23 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of CCL23 promoter CTD PMID:27901495 Ccl9 Mouse bis(2-chloroethyl) sulfide increases expression EXP 6480464 Mustard Gas results in increased expression of CCL9 mRNA CTD PMID:15674844 Ccl9 Mouse bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of CCL9 mRNA CTD PMID:25594700 Ccl9 Mouse bisphenol F decreases expression EXP 6480464 bisphenol F results in decreased expression of CCL9 mRNA CTD PMID:38685157 Ccl9 Mouse cadmium atom multiple interactions ISO CCL23 (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of CCL23 mRNA CTD PMID:35301059 Ccl9 Mouse cadmium dichloride multiple interactions ISO CCL23 (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of CCL23 mRNA CTD PMID:35301059 Ccl9 Mouse cannabidiol decreases expression EXP 6480464 Cannabidiol results in decreased expression of CCL9 mRNA CTD PMID:21542829 Ccl9 Mouse carbon nanotube increases expression ISO CCL23 (Homo sapiens) 6480464 Nanotubes and Carbon results in increased expression of CCL23 mRNA CTD PMID:29348435 Ccl9 Mouse carbon nanotube decreases expression EXP 6480464 Nanotubes and Carbon results in decreased expression of CCL9 mRNA CTD PMID:25620056 Ccl9 Mouse carbon nanotube increases expression EXP 6480464 Nanotubes more ... CTD PMID:21135415 more ... Ccl9 Mouse cetirizine multiple interactions EXP 6480464 [Cetirizine co-treated with Dietary Fats co-treated with APOE gene mutant form] results in decreased expression of CCL23 protein CTD PMID:25020133 Ccl9 Mouse CGP 52608 multiple interactions ISO CCL23 (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to CCL23 gene] CTD PMID:28238834 Ccl9 Mouse chloroquine multiple interactions EXP 6480464 Chloroquine inhibits the reaction [lipopolysaccharide and Escherichia coli O111 B4 results in increased secretion of CCL9 protein] CTD PMID:22341560 Ccl9 Mouse chlorpyrifos increases expression EXP 6480464 Chlorpyrifos results in increased expression of CCL9 mRNA CTD PMID:32715474 Ccl9 Mouse choline multiple interactions EXP 6480464 [PANX1 gene mutant form affects the susceptibility to [Dietary Fats co-treated with Choline deficiency]] which results in decreased expression of CCL9 protein CTD PMID:29246445 Ccl9 Mouse cisplatin increases expression EXP 6480464 Cisplatin results in increased expression of CCL9 mRNA CTD PMID:21151649 Ccl9 Mouse cisplatin increases expression ISO CCL23 (Homo sapiens) 6480464 Cisplatin results in increased expression of CCL23 mRNA CTD PMID:27594783 Ccl9 Mouse cobalt atom multiple interactions EXP 6480464 [Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in decreased expression of CCL9 mRNA and TNF protein promotes the reaction [[Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in decreased expression of CCL9 mRNA] CTD PMID:23503329 Ccl9 Mouse crocidolite asbestos increases expression EXP 6480464 Asbestos more ... CTD PMID:21135415 more ... Ccl9 Mouse cyclophosphamide increases expression EXP 6480464 Cyclophosphamide results in increased expression of CCL9 mRNA CTD PMID:21041162 Ccl9 Mouse cyproconazole increases expression EXP 6480464 cyproconazole results in increased expression of CCL9 mRNA CTD PMID:22334560 Ccl9 Mouse D-glucose multiple interactions EXP 6480464 [lard co-treated with Cholesterol and Dietary co-treated with Dietary Sucrose co-treated with Fructose co-treated with Glucose] results in increased expression of CCL9 mRNA CTD PMID:37567420 Ccl9 Mouse dexamethasone increases expression EXP 6480464 Dexamethasone results in increased expression of CCL9 mRNA CTD PMID:21041162 Ccl9 Mouse dexamethasone multiple interactions EXP 6480464 [Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in decreased expression of CCL9 mRNA and TNF protein promotes the reaction [[Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in decreased expression of CCL9 mRNA] CTD PMID:23503329 Ccl9 Mouse dextran sulfate multiple interactions EXP 6480464 [titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in decreased expression of CCL9 mRNA CTD PMID:29950665 Ccl9 Mouse dextran sulfate increases expression EXP 6480464 Dextran Sulfate results in increased expression of CCL9 mRNA CTD PMID:35093514 Ccl9 Mouse diarsenic trioxide increases expression ISO CCL23 (Homo sapiens) 6480464 Arsenic Trioxide results in increased expression of CCL23 mRNA CTD PMID:15761015 Ccl9 Mouse diclofenac increases expression EXP 6480464 Diclofenac results in increased expression of CCL9 mRNA CTD PMID:26934552 Ccl9 Mouse diethyl malate affects expression EXP 6480464 diethyl malate affects the expression of CCL9 mRNA CTD PMID:24814887 Ccl9 Mouse diethylstilbestrol increases expression EXP 6480464 Diethylstilbestrol results in increased expression of CCL9 mRNA CTD PMID:21041162 Ccl9 Mouse dioxygen multiple interactions EXP 6480464 [NFE2L2 protein affects the susceptibility to Oxygen] which affects the expression of CCL9 mRNA CTD PMID:30529165 Ccl9 Mouse epoxiconazole increases expression EXP 6480464 epoxiconazole results in increased expression of CCL9 mRNA CTD PMID:22334560 Ccl9 Mouse epoxiconazole decreases expression EXP 6480464 epoxiconazole results in decreased expression of CCL9 mRNA CTD PMID:35436446 Ccl9 Mouse ethanol increases expression EXP 6480464 Ethanol results in increased expression of CCL9 mRNA CTD PMID:19167417 Ccl9 Mouse folic acid multiple interactions EXP 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of CCL9 mRNA CTD PMID:22206623 Ccl9 Mouse fructose multiple interactions EXP 6480464 [lard co-treated with Cholesterol and Dietary co-treated with Dietary Sucrose co-treated with Fructose co-treated with Glucose] results in increased expression of CCL9 mRNA CTD PMID:37567420 Ccl9 Mouse genistein decreases expression EXP 6480464 Genistein results in decreased expression of CCL9 mRNA CTD PMID:32186404 Ccl9 Mouse glucose multiple interactions EXP 6480464 [lard co-treated with Cholesterol and Dietary co-treated with Dietary Sucrose co-treated with Fructose co-treated with Glucose] results in increased expression of CCL9 mRNA CTD PMID:37567420 Ccl9 Mouse graphene oxide increases expression EXP 6480464 graphene oxide results in increased expression of CCL9 mRNA CTD PMID:33227293 Ccl9 Mouse griseofulvin affects expression EXP 6480464 Griseofulvin affects the expression of CCL9 mRNA CTD PMID:12735108 Ccl9 Mouse isoprenaline increases expression EXP 6480464 Isoproterenol results in increased expression of CCL9 mRNA CTD PMID:20003209 Ccl9 Mouse lipopolysaccharide multiple interactions EXP 6480464 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [Lipopolysaccharides results in increased expression of CCL9 mRNA] more ... CTD PMID:22225513 Ccl9 Mouse lipopolysaccharide increases expression EXP 6480464 Lipopolysaccharides results in increased expression of CCL9 mRNA CTD PMID:22225513 and PMID:26582142 Ccl9 Mouse LY294002 multiple interactions EXP 6480464 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [Lipopolysaccharides results in increased expression of CCL9 mRNA] CTD PMID:22225513 Ccl9 Mouse medroxyprogesterone acetate increases expression ISO CCL23 (Homo sapiens) 6480464 Medroxyprogesterone Acetate results in increased expression of CCL23 mRNA CTD PMID:20843944 Ccl9 Mouse melatonin multiple interactions EXP 6480464 Melatonin inhibits the reaction [Lipopolysaccharides results in increased expression of CCL9 mRNA] CTD PMID:22225513 Ccl9 Mouse methidathion increases expression EXP 6480464 methidathion results in increased expression of CCL9 mRNA CTD PMID:34813904 Ccl9 Mouse methylmercury chloride increases expression EXP 6480464 methylmercuric chloride results in increased expression of CCL9 mRNA CTD PMID:24213012 Ccl9 Mouse microcystin-LR increases expression EXP 6480464 cyanoginosin LR results in increased expression of CCL9 mRNA CTD PMID:37342990 Ccl9 Mouse monosodium L-glutamate multiple interactions EXP 6480464 [Trans Fatty Acids co-treated with Sodium Glutamate] results in increased expression of CCL9 mRNA CTD PMID:22078008 Ccl9 Mouse N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal decreases expression EXP 6480464 benzyloxycarbonylleucyl-leucyl-leucine aldehyde results in decreased expression of CCL9 mRNA CTD PMID:25566086 Ccl9 Mouse naphthalene increases expression EXP 6480464 naphthalene results in increased expression of CCL9 mRNA CTD PMID:18978301 Ccl9 Mouse nickel atom multiple interactions EXP 6480464 [Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in decreased expression of CCL9 mRNA and TNF protein promotes the reaction [[Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in decreased expression of CCL9 mRNA] CTD PMID:23503329 Ccl9 Mouse nickel dichloride increases secretion ISO CCL23 (Homo sapiens) 6480464 nickel chloride results in increased secretion of CCL9 protein CTD PMID:18437699 Ccl9 Mouse paracetamol affects expression EXP 6480464 Acetaminophen affects the expression of CCL9 mRNA CTD PMID:17562736 Ccl9 Mouse paracetamol decreases expression EXP 6480464 Acetaminophen results in decreased expression of CCL9 mRNA CTD PMID:11264010 Ccl9 Mouse perfluorooctane-1-sulfonic acid multiple interactions EXP 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in increased expression of CCL9 mRNA and [perfluorooctane sulfonic acid co-treated with Pectins] results in increased expression of CCL9 mRNA CTD PMID:36331819 Ccl9 Mouse phenobarbital increases expression EXP 6480464 Phenobarbital results in increased expression of CCL9 mRNA CTD PMID:19270015 more ... Ccl9 Mouse phorbol 13-acetate 12-myristate multiple interactions EXP 6480464 [Methylcholanthrene co-treated with Tetradecanoylphorbol Acetate] results in decreased expression of CCL9 mRNA CTD PMID:23519560 Ccl9 Mouse pirinixic acid decreases expression EXP 6480464 pirinixic acid results in decreased expression of CCL9 mRNA CTD PMID:23811191 Ccl9 Mouse pregnenolone 16alpha-carbonitrile increases expression EXP 6480464 Pregnenolone Carbonitrile results in increased expression of CCL9 mRNA CTD PMID:28903501 Ccl9 Mouse progesterone affects expression EXP 6480464 Progesterone affects the expression of CCL9 mRNA CTD PMID:17251523 Ccl9 Mouse propiconazole increases expression EXP 6480464 propiconazole results in increased expression of CCL9 mRNA CTD PMID:21278054 and PMID:22334560 Ccl9 Mouse pyrrolidine dithiocarbamate multiple interactions EXP 6480464 pyrrolidine dithiocarbamic acid inhibits the reaction [Lipopolysaccharides results in increased expression of CCL9 mRNA] CTD PMID:22225513 Ccl9 Mouse serpentine asbestos increases expression EXP 6480464 Asbestos and Serpentine results in increased expression of CCL9 mRNA CTD PMID:16251409 Ccl9 Mouse silicon dioxide increases expression EXP 6480464 Silicon Dioxide results in increased expression of CCL9 mRNA CTD PMID:23221170 and PMID:29341224 Ccl9 Mouse sodium arsenite decreases expression EXP 6480464 sodium arsenite results in decreased expression of CCL9 mRNA CTD PMID:37682722 Ccl9 Mouse tetrachloromethane increases expression EXP 6480464 Carbon Tetrachloride results in increased expression of CCL9 mRNA and Carbon Tetrachloride results in increased expression of CCL9 protein CTD PMID:17484886 more ... Ccl9 Mouse tetrachloromethane affects expression EXP 6480464 Carbon Tetrachloride affects the expression of CCL9 mRNA CTD PMID:31919559 Ccl9 Mouse titanium dioxide increases expression EXP 6480464 titanium dioxide results in increased expression of CCL9 mRNA CTD PMID:21259345 more ... Ccl9 Mouse titanium dioxide multiple interactions EXP 6480464 [titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in decreased expression of CCL9 mRNA CTD PMID:29950665 Ccl9 Mouse TMC-120A increases expression EXP 6480464 TMC 120A results in increased expression of CCL9 mRNA CTD PMID:19818335 Ccl9 Mouse toluene 2,4-diisocyanate increases expression EXP 6480464 Toluene 2 and 4-Diisocyanate results in increased expression of CCL9 mRNA CTD PMID:19647056 and PMID:21404309 Ccl9 Mouse tremolite asbestos increases expression EXP 6480464 tremolite results in increased expression of CCL9 mRNA CTD PMID:29279043 Ccl9 Mouse trimellitic anhydride increases expression EXP 6480464 trimellitic anhydride results in increased expression of CCL9 mRNA CTD PMID:16141432 and PMID:19042947 Ccl9 Mouse troglitazone increases expression EXP 6480464 troglitazone results in increased expression of CCL9 mRNA CTD PMID:28973697 Ccl9 Mouse wortmannin multiple interactions EXP 6480464 wortmannin inhibits the reaction [Lipopolysaccharides results in increased expression of CCL9 mRNA] CTD PMID:22225513 Ccl9 Mouse zinc atom multiple interactions EXP 6480464 [Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in decreased expression of CCL9 mRNA and TNF protein promotes the reaction [[Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in decreased expression of CCL9 mRNA] CTD PMID:23503329 Ccl9 Mouse zinc(0) multiple interactions EXP 6480464 [Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in decreased expression of CCL9 mRNA and TNF protein promotes the reaction [[Zinc co-treated with Nickel co-treated with Cobalt co-treated with 1-Methyl-3-isobutylxanthine co-treated with Dexamethasone co-treated with INS1 protein] results in decreased expression of CCL9 mRNA] CTD PMID:23503329 Ccl9 Mouse zoledronic acid increases expression ISO CCL23 (Homo sapiens) 6480464 Zoledronic Acid results in increased expression of CCL23 mRNA CTD PMID:24714768
(1->4)-beta-D-glucan (EXP) 1,1-dichloroethene (EXP) 1,2-dimethylhydrazine (EXP) 1-chloro-2,4-dinitrobenzene (EXP) 17beta-estradiol (EXP) 2,2',4,4'-Tetrabromodiphenyl ether (EXP) 2,3,7,8-tetrachlorodibenzodioxine (EXP) 2,4,6-trinitrobenzenesulfonic acid (EXP) 2,4-dibromophenyl 2,4,5-tribromophenyl ether (EXP) 3-isobutyl-1-methyl-7H-xanthine (EXP) 3-methylcholanthrene (EXP) 4,4'-diaminodiphenylmethane (EXP) 4,4'-sulfonyldiphenol (EXP) 4-(ethoxymethylene)-2-phenyloxazol-5-one (EXP) aflatoxin B1 (EXP) aldehydo-D-glucose (EXP) all-trans-retinoic acid (ISO) alpha-amanitin (EXP) antirheumatic drug (ISO) arsenous acid (ISO) Azoxymethane (EXP) benzo[a]pyrene (EXP,ISO) bis(2-chloroethyl) sulfide (EXP) bisphenol A (EXP) bisphenol F (EXP) cadmium atom (ISO) cadmium dichloride (ISO) cannabidiol (EXP) carbon nanotube (EXP,ISO) cetirizine (EXP) CGP 52608 (ISO) chloroquine (EXP) chlorpyrifos (EXP) choline (EXP) cisplatin (EXP,ISO) cobalt atom (EXP) crocidolite asbestos (EXP) cyclophosphamide (EXP) cyproconazole (EXP) D-glucose (EXP) dexamethasone (EXP) dextran sulfate (EXP) diarsenic trioxide (ISO) diclofenac (EXP) diethyl malate (EXP) diethylstilbestrol (EXP) dioxygen (EXP) epoxiconazole (EXP) ethanol (EXP) folic acid (EXP) fructose (EXP) genistein (EXP) glucose (EXP) graphene oxide (EXP) griseofulvin (EXP) isoprenaline (EXP) lipopolysaccharide (EXP) LY294002 (EXP) medroxyprogesterone acetate (ISO) melatonin (EXP) methidathion (EXP) methylmercury chloride (EXP) microcystin-LR (EXP) monosodium L-glutamate (EXP) N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal (EXP) naphthalene (EXP) nickel atom (EXP) nickel dichloride (ISO) paracetamol (EXP) perfluorooctane-1-sulfonic acid (EXP) phenobarbital (EXP) phorbol 13-acetate 12-myristate (EXP) pirinixic acid (EXP) pregnenolone 16alpha-carbonitrile (EXP) progesterone (EXP) propiconazole (EXP) pyrrolidine dithiocarbamate (EXP) serpentine asbestos (EXP) silicon dioxide (EXP) sodium arsenite (EXP) tetrachloromethane (EXP) titanium dioxide (EXP) TMC-120A (EXP) toluene 2,4-diisocyanate (EXP) tremolite asbestos (EXP) trimellitic anhydride (EXP) troglitazone (EXP) wortmannin (EXP) zinc atom (EXP) zinc(0) (EXP) zoledronic acid (ISO)
Ccl9 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 11 83,463,743 - 83,469,462 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 11 83,463,745 - 83,469,462 (-) Ensembl GRCm39 Ensembl GRCm38 11 83,572,917 - 83,578,636 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 11 83,572,919 - 83,578,636 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 11 83,386,419 - 83,392,138 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 11 83,389,112 - 83,394,831 (-) NCBI MGSCv36 mm8 Celera 11 93,174,716 - 93,180,435 (-) NCBI Celera Cytogenetic Map 11 C NCBI cM Map 11 50.81 NCBI
CCL23 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 17 36,013,058 - 36,017,972 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 17 36,013,056 - 36,017,972 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 17 34,340,098 - 34,345,009 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 17 31,364,210 - 31,369,118 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 17 31,364,209 - 31,369,118 NCBI Celera 17 31,249,651 - 31,254,560 (-) NCBI Celera Cytogenetic Map 17 q12 NCBI HuRef 17 30,524,964 - 30,529,874 (-) NCBI HuRef CHM1_1 17 34,404,627 - 34,409,539 (-) NCBI CHM1_1 T2T-CHM13v2.0 17 36,960,963 - 36,965,877 (-) NCBI T2T-CHM13v2.0
CCL23 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 19 28,459,908 - 28,464,833 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 17 30,338,865 - 30,343,790 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 17 20,778,008 - 20,782,929 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 17 21,073,882 - 21,078,794 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 17 21,073,882 - 21,078,794 (+) Ensembl panpan1.1 panPan2
.
Predicted Target Of
Count of predictions: 750 Count of miRNA genes: 505 Interacting mature miRNAs: 562 Transcripts: ENSMUST00000019266, ENSMUST00000136131 Prediction methods: Miranda, Rnahybrid Result types: miRGate_prediction
27226783 Tibl5_m tibia length 5, 5 week (mouse) 11 68190826 101890826 Mouse 1300628 Lgth6_m body length 6 (mouse) Not determined 11 66733420 100733652 Mouse 4141367 Inf1_m acute ozone induced inflammation (mouse) Not determined 44630038 113058009 Mouse 1558812 Rafar_m retinoic acid induced forelimb autopod reduction (mouse) Not determined 11 70691198 104691366 Mouse 1300766 Skull16_m skull morphology 16 (mouse) Not determined 11 81574481 115574636 Mouse 1301404 Sbmd4_m spinal bone mineral density 4 (mouse) Not determined 11 72019649 106019734 Mouse 4142121 Tmc1m2_m Tmc1 modifier 2 (mouse) Not determined 11 56864027 114157957 Mouse 27226758 Femd3_m femur midshaft diameter 3, 5 week (mouse) 11 80890826 101890826 Mouse 1301640 Lore4_m loss of righting induced by ethanol 4 (mouse) Not determined 11 79156009 107616472 Mouse 10412288 Carg4_m Candida albicans resistance gene 4 (mouse) Not determined 11 81810267 115810267 Mouse 4141982 Skts-fp2_m skin tumor susceptibility in FVB and PWK 2 (mouse) Not determined 58719266 85066529 Mouse 1357878 Mastr_m modifier of astrocytoma (mouse) Not determined 11 45708581 89818733 Mouse 1301681 Sle13_m systematic lupus erythematosus susceptibility 13 (mouse) Not determined 11 70691198 104691366 Mouse 1300784 Prdt3_m prion disease incubation time 3 (mouse) Not determined 11 66733420 100733652 Mouse 4141339 Nilac2_m nicotine induced locomotor activity 2 (mouse) Not determined 11 70691198 104691366 Mouse 10413882 Moe1_m modifier of epilepsy 1 (mouse) 11 77770978 111771099 Mouse 11039501 Ltpr6a_m Leishmania tropica response 6a (mouse) 11 64830336 98830473 Mouse 13208559 Wght10_m weight 10 (mouse) 11 3950000 88890826 Mouse 13524840 Ppiq9a_m prepulse inhibition QTL 9a (mouse) 11 52494385 86494385 Mouse 11039502 Ltpr6b_m Leishmania tropica response 6b (mouse) 11 64830336 98830473 Mouse 13208558 Lgth12_m body length 12 (mouse) 11 3950000 94890826 Mouse 10045616 Heal25_m wound healing/regeneration 25 (mouse) Not determined 11 77437183 111437322 Mouse 1300664 Etohcta9_m ethanol conditioned taste aversion 9 (mouse) Not determined 11 57754660 91754758 Mouse 1301310 Tmevd5_m Theiler's murine encephalomyelitis virus induced demyelinating disease susceptibility 5 (mouse) Not determined 11 72726125 106726289 Mouse 1300924 Ity2_m immunity to S. typhimurium 2 (mouse) Not determined 1 58508030 87695238 Mouse 13208569 Bmiq10_m body mass index QTL 10 (mouse) 11 35890827 84890826 Mouse 11039515 Ltpr6_m Leishmania tropica response 6 (mouse) 11 64830336 98830473 Mouse 4142348 Pstc2_m periosteal circumference 2 (mouse) Not determined 11 72818615 106818733 Mouse 1300774 Pgia7_m proteoglycan induced arthritis 7 (mouse) Not determined 11 53390588 87390737 Mouse 1301414 Heal10_m wound healing/regeneration 10 (mouse) Not determined 11 77437183 111437322 Mouse 1300651 Pcyts3_m plasmacytoma susceptibility 3 (mouse) Not determined 11 70691198 104691366 Mouse 4141830 Pregq1_m pregnancy QTL 1 (mouse) Not determined 11 54126752 83733652 Mouse 1301546 Pcir2_m periosteal circumference 2 (mouse) Not determined 11 66733420 100733652 Mouse 1300905 Scc6_m colon tumor susceptibility 6 (mouse) Not determined 11 6880277 89019734 Mouse 1300649 Crhq1_m compensatory renal hypertrophy QTL 1 (mouse) Not determined 11 81574481 115574636 Mouse 14746970 Manh71_m mandible shape 71 (mouse) 11 79416257 113416257 Mouse 10043865 T2dm5sa_m type 2 diabetes mellitus 5 in SMXA RI mice (mouse) Not determined 11 79813759 104502698 Mouse 39128214 Lwq20_m liver weight QTL 20 (mouse) 11 12268637 118022724 Mouse 1301328 Mol4_m modifier of LPS-response 4 (mouse) Not determined 11 36282577 83481356 Mouse 10043866 Adip19_m adiposity 19 (mouse) Not determined 11 72818615 106818733 Mouse 1301072 Eae22_m experimental allergic encephalomyelitis 22 (mouse) Not determined 11 82377698 116377820 Mouse 1301078 Alcp2_m alcohol preference locus 2 (mouse) Not determined 11 72209796 84731462 Mouse 10412246 Dfs2_m dental fluorosis suseptibility 2 (mouse) Not determined 11 21807364 95881231 Mouse 11038695 Par8_m pulmonary adenoma resistance 8 (mouse) 11 77063779 111063918 Mouse 1357766 Si5lq6_m serum IGFBP-5 level QTL 6 (mouse) Not determined 11 66733420 100733652 Mouse 1301319 Dautb4_m dopamine uptake transporter binding 4 (mouse) Not determined 11 62156005 96156153 Mouse 1301830 Ssta4_m susceptibility to Salmonella typhimurium antigens 4 (mouse) Not determined 11 50078191 84078411 Mouse 1301833 Tbbmd5_m total body bone mineral density 5 (mouse) Not determined 11 66733420 100733652 Mouse 4141012 Femwf6_m femur work to failure 6 (mouse) Not determined 66733420 100733652 Mouse 1301987 Pid3_m prior incubation determinant 3 (mouse) Not determined 11 61686820 88699728 Mouse 27226730 Tibmd1_m tibia midshaft diameter 1, 5 week (mouse) 11 62590826 109390826 Mouse 4141894 Nidd6k_m Nidd6 on KK-A (mouse) Not determined 19124204 96897826 Mouse 10044004 Stzid3_m streptozotocin induced diabetes susceptibility 3 (mouse) Not determined 11 63319407 94063918 Mouse 1302124 Eae7_m susceptibility to experimental allergic encephalomyelitis 7 (mouse) Not determined 11 77573873 99377820 Mouse
U15209
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 11 83,575,168 - 83,575,336 UniSTS GRCm38 MGSCv37 11 83,388,670 - 83,388,838 UniSTS GRCm37 Celera 11 93,176,967 - 93,177,135 UniSTS Cytogenetic Map 11 C UniSTS cM Map 11 47.4 UniSTS Whitehead_YAC 11 UniSTS
Ccl9
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 11 83,574,716 - 83,575,463 UniSTS GRCm38 MGSCv37 11 83,388,218 - 83,388,965 UniSTS GRCm37 Celera 11 93,176,515 - 93,177,262 UniSTS Cytogenetic Map 11 C UniSTS cM Map 11 47.4 UniSTS
D10Mit157.2
Mouse Assembly Chr Position (strand) Source JBrowse Cytogenetic Map 6 D1 UniSTS Cytogenetic Map 16 B4 UniSTS Cytogenetic Map 18 E2 UniSTS Cytogenetic Map 4 C3 UniSTS Cytogenetic Map 7 B2 UniSTS Cytogenetic Map 4 D2.3 UniSTS Cytogenetic Map 11 E1 UniSTS Cytogenetic Map 14 E2.2 UniSTS Cytogenetic Map 4 C7 UniSTS Cytogenetic Map 2 H4 UniSTS Cytogenetic Map 1 F UniSTS Cytogenetic Map 6 C3 UniSTS Cytogenetic Map 11 D UniSTS Cytogenetic Map 3 G2 UniSTS Cytogenetic Map 17 A1 UniSTS Cytogenetic Map 9 F2 UniSTS Cytogenetic Map 12 F1 UniSTS Cytogenetic Map 19 C2 UniSTS Cytogenetic Map 3 B UniSTS Cytogenetic Map 8 C1 UniSTS Cytogenetic Map 18 A2 UniSTS Cytogenetic Map 3 F2 UniSTS Cytogenetic Map 14 C3 UniSTS Cytogenetic Map 8 E1 UniSTS Cytogenetic Map 8 E2 UniSTS Cytogenetic Map 5 B1 UniSTS Cytogenetic Map 18 B1 UniSTS Cytogenetic Map 9 C UniSTS Cytogenetic Map 14 C2 UniSTS Cytogenetic Map 6 A1 UniSTS Cytogenetic Map 10 B4 UniSTS Cytogenetic Map 13 D2.1 UniSTS Cytogenetic Map 5 E5 UniSTS Cytogenetic Map 11 B1.3 UniSTS Cytogenetic Map 4 D1 UniSTS Cytogenetic Map 9 A5.2 UniSTS Cytogenetic Map 3 F1 UniSTS Cytogenetic Map 17 E3 UniSTS Cytogenetic Map 11 B3 UniSTS Cytogenetic Map 1 H4 UniSTS Cytogenetic Map 6 A3 UniSTS Cytogenetic Map 5 E4-E5 UniSTS Cytogenetic Map 15 E1 UniSTS Cytogenetic Map 13 D UniSTS Cytogenetic Map 14 B UniSTS Cytogenetic Map 14 D1 UniSTS Cytogenetic Map 7 B4 UniSTS Cytogenetic Map 8 D3 UniSTS Cytogenetic Map X D UniSTS Cytogenetic Map 17 A3.3 UniSTS Cytogenetic Map 7 E2 UniSTS Cytogenetic Map 1 H2.3 UniSTS Cytogenetic Map 7 A2 UniSTS Cytogenetic Map 7 F3 UniSTS Cytogenetic Map 9 F1 UniSTS Cytogenetic Map 10 C1 UniSTS Cytogenetic Map 4 E2 UniSTS Cytogenetic Map 16 A1 UniSTS Cytogenetic Map 8 B3.3 UniSTS Cytogenetic Map 8 D2 UniSTS Cytogenetic Map 3 D UniSTS Cytogenetic Map 15 D2 UniSTS Cytogenetic Map 17 B1 UniSTS Cytogenetic Map 7 A3 UniSTS Cytogenetic Map 15 F1 UniSTS Cytogenetic Map 16 B2 UniSTS Cytogenetic Map 7 C UniSTS Cytogenetic Map 3 F2.1 UniSTS Cytogenetic Map 6 F3 UniSTS Cytogenetic Map 1 C4 UniSTS Cytogenetic Map 11 E2 UniSTS Cytogenetic Map 11 B5 UniSTS Cytogenetic Map 9 F3 UniSTS Cytogenetic Map 2 B UniSTS Cytogenetic Map 13 B3 UniSTS Cytogenetic Map 9 A4 UniSTS Cytogenetic Map 5 A3 UniSTS Cytogenetic Map 2 H1 UniSTS Cytogenetic Map 16 B1 UniSTS Cytogenetic Map 1 A5 UniSTS Cytogenetic Map 11 C UniSTS Cytogenetic Map 9 E1 UniSTS Cytogenetic Map 6 G1 UniSTS Cytogenetic Map X A2 UniSTS Cytogenetic Map 13 B1 UniSTS Cytogenetic Map 5 E2 UniSTS Cytogenetic Map 12 C1 UniSTS Cytogenetic Map 5 F UniSTS Cytogenetic Map 4 D3 UniSTS Cytogenetic Map 10 C2 UniSTS Cytogenetic Map 9 B UniSTS Cytogenetic Map 5 G2 UniSTS Cytogenetic Map 7 F1 UniSTS Cytogenetic Map 12 C3 UniSTS Cytogenetic Map 10 A4 UniSTS Cytogenetic Map 8 A2 UniSTS Cytogenetic Map 18 A1 UniSTS Cytogenetic Map 12 A1.1 UniSTS Cytogenetic Map 1 C2 UniSTS Cytogenetic Map 11 B2 UniSTS Cytogenetic Map 6 E3 UniSTS Cytogenetic Map 5 C3.3 UniSTS Cytogenetic Map 1 B UniSTS Cytogenetic Map 17 A3.1 UniSTS Cytogenetic Map 7 A1 UniSTS Cytogenetic Map 2 E5 UniSTS Cytogenetic Map 11 A1 UniSTS Cytogenetic Map 4 B1 UniSTS Cytogenetic Map 15 A2 UniSTS Cytogenetic Map 8 C3 UniSTS Cytogenetic Map 2 A3 UniSTS Cytogenetic Map 5 G3 UniSTS Cytogenetic Map 4 A3 UniSTS Cytogenetic Map 2 H3 UniSTS Cytogenetic Map 8 A1 UniSTS Cytogenetic Map 8 A1.1 UniSTS Cytogenetic Map 16 A3 UniSTS Cytogenetic Map 10 B1 UniSTS Cytogenetic Map 19 A UniSTS Cytogenetic Map 10 A1 UniSTS Cytogenetic Map 13 D1 UniSTS Cytogenetic Map 4 A1 UniSTS Cytogenetic Map 9 A3 UniSTS Cytogenetic Map 17 C UniSTS Cytogenetic Map 1 D UniSTS Cytogenetic Map 5 E3 UniSTS Cytogenetic Map 15 D3 UniSTS Cytogenetic Map 2 H2 UniSTS Cytogenetic Map 7 D3 UniSTS Cytogenetic Map 2 A1 UniSTS Cytogenetic Map 14 C1 UniSTS Cytogenetic Map 14 E5 UniSTS Cytogenetic Map 10 C UniSTS Cytogenetic Map 18 B2 UniSTS Cytogenetic Map 2 F1 UniSTS Cytogenetic Map 10 D3 UniSTS Cytogenetic Map 17 A2 UniSTS Cytogenetic Map 2 C3 UniSTS Cytogenetic Map 1 C3 UniSTS Cytogenetic Map 17 B2 UniSTS Cytogenetic Map 5 B2 UniSTS Cytogenetic Map 5 G1 UniSTS Cytogenetic Map 4 C6 UniSTS Cytogenetic Map 13 C3 UniSTS Cytogenetic Map 2 E1 UniSTS Cytogenetic Map 17 A3.2-A3.3 UniSTS Cytogenetic Map 19 C3 UniSTS Cytogenetic Map 7 E3 UniSTS Cytogenetic Map 13 C1 UniSTS Cytogenetic Map 9 E3.1 UniSTS Cytogenetic Map 15 E3 UniSTS Cytogenetic Map 6 B1 UniSTS Cytogenetic Map X E3 UniSTS Cytogenetic Map 4 C4 UniSTS Cytogenetic Map 3 E3 UniSTS Cytogenetic Map 11 A4 UniSTS Cytogenetic Map 4 C5 UniSTS Cytogenetic Map 18 B3 UniSTS Cytogenetic Map 9 A2 UniSTS Cytogenetic Map 7 E1 UniSTS Cytogenetic Map 5 D-E1 UniSTS Cytogenetic Map 5 B3 UniSTS Cytogenetic Map 13 A2-A3 UniSTS Cytogenetic Map 5 A2 UniSTS Cytogenetic Map 4 B3 UniSTS Cytogenetic Map 1 E4 UniSTS Cytogenetic Map 17 E4 UniSTS Cytogenetic Map 1 G2 UniSTS Cytogenetic Map 15 B3.1 UniSTS Cytogenetic Map 12 E UniSTS Cytogenetic Map X A5 UniSTS Cytogenetic Map 6 A3.3 UniSTS Cytogenetic Map 6 G3 UniSTS Cytogenetic Map 6 F2 UniSTS Cytogenetic Map 5 C1 UniSTS Cytogenetic Map 4 D2.1 UniSTS Cytogenetic Map 4 A5 UniSTS Cytogenetic Map 3 F2.2 UniSTS Cytogenetic Map 1 E3-E4 UniSTS Cytogenetic Map 9 F1-F3 UniSTS Cytogenetic Map 1 C1.1 UniSTS Cytogenetic Map 14 D2 UniSTS Cytogenetic Map 12 A2 UniSTS Cytogenetic Map 17 A3-B UniSTS Cytogenetic Map 7 F5 UniSTS Cytogenetic Map 14 A3 UniSTS Cytogenetic Map 5 G1.1 UniSTS Cytogenetic Map X F2-F4 UniSTS Cytogenetic Map 7 D2 UniSTS Cytogenetic Map 2 F3 UniSTS Cytogenetic Map 10 A3 UniSTS Cytogenetic Map X A7.3 UniSTS Cytogenetic Map 9 F1-F2 UniSTS Cytogenetic Map 13 A3.2 UniSTS Cytogenetic Map 10 A2 UniSTS Cytogenetic Map 1 C1 UniSTS Cytogenetic Map 1 A1 UniSTS Cytogenetic Map 12 D3 UniSTS Cytogenetic Map 1 A3-A5 UniSTS Cytogenetic Map 2 A2 UniSTS Cytogenetic Map 3 A1 UniSTS Cytogenetic Map X A3.3 UniSTS Cytogenetic Map 16 A-B1 UniSTS Cytogenetic Map 1 D2.3 UniSTS Cytogenetic Map 6 B2.3 UniSTS Cytogenetic Map 2 G3 UniSTS Cytogenetic Map X A2-A3.1 UniSTS Cytogenetic Map 9 A5.3 UniSTS Cytogenetic Map 14 A2-B UniSTS Cytogenetic Map 8 E1-E2 UniSTS Cytogenetic Map 8 A3 UniSTS Cytogenetic Map 1 G3-H1 UniSTS Cytogenetic Map 8 B3-C1 UniSTS Cytogenetic Map 19 C1 UniSTS Cytogenetic Map 8 C5 UniSTS Cytogenetic Map 8 A4 UniSTS Cytogenetic Map 15 F3 UniSTS Cytogenetic Map 14 E4 UniSTS Cytogenetic Map 4 D2.2 UniSTS Cytogenetic Map X F5 UniSTS cM Map 10 40.0 UniSTS Whitehead Genetic 10 33.9 UniSTS
Scya9
Mouse Assembly Chr Position (strand) Source JBrowse Cytogenetic Map 11 C UniSTS cM Map 11 47.4 UniSTS
Ccl9
Mouse Assembly Chr Position (strand) Source JBrowse Cytogenetic Map 11 C UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000019266 ⟹ ENSMUSP00000019266
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 11 83,463,745 - 83,469,462 (-) Ensembl GRCm38.p6 Ensembl 11 83,572,919 - 83,578,636 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000136131
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 11 83,466,144 - 83,467,968 (-) Ensembl GRCm38.p6 Ensembl 11 83,575,318 - 83,577,142 (-) Ensembl
RefSeq Acc Id:
NM_011338 ⟹ NP_035468
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 11 83,463,743 - 83,469,462 (-) NCBI GRCm38 11 83,572,917 - 83,578,636 (-) ENTREZGENE MGSCv37 11 83,386,419 - 83,392,138 (-) RGD Celera 11 93,174,716 - 93,180,435 (-) RGD cM Map 11 ENTREZGENE
Sequence:
ACTGCACACTGTTCCCTCTCTTAGAACTAGCATGTTGGGTGTTATGTAGTCAAAGGAGGGCATTATGAGCTGTACCCCAGGGACTTCCTGATCCTCTTACATGTATAAATAGCAAGACCGGGCCAGGA
hide sequence
RefSeq Acc Id:
NP_035468 ⟸ NM_011338
- Peptide Label:
precursor
- UniProtKB:
Q5QNW2 (UniProtKB/Swiss-Prot), P51670 (UniProtKB/Swiss-Prot), Q3U9T8 (UniProtKB/TrEMBL), Q2M4I0 (UniProtKB/TrEMBL), Q3U3N8 (UniProtKB/TrEMBL)
- Sequence:
MKPFHTALSFLILTTALGIWAQITHATETKEVQSSLKAQQGLEIEMFHMGFQDSSDCCLSYNSRIQCSRFIGYFPTSGGCTRPGIIFISKRGFQVCANPSDRRVQRCIERLEQNSQPRTYKQ
hide sequence
Ensembl Acc Id:
ENSMUSP00000019266 ⟸ ENSMUST00000019266
RGD ID: 6820579 Promoter ID: MM_KWN:8901 Type: Non-CpG SO ACC ID: SO:0000170 Source: MPROMDB Tissues & Cell Lines: BoneMarrow_0Hour, BoneMarrow_2Hour, BoneMarrow_4Hour Transcripts: OTTMUST00000001962 Position: Mouse Assembly Chr Position (strand) Source MGSCv36 11 83,390,361 - 83,391,412 (-) MPROMDB
RGD ID: 6820578 Promoter ID: MM_KWN:8902 Type: Non-CpG SO ACC ID: SO:0000170 Source: MPROMDB Tissues & Cell Lines: BoneMarrow_0Hour, BoneMarrow_2Hour, BoneMarrow_4Hour, Liver Transcripts: ENSMUST00000108129, NM_011338 Position: Mouse Assembly Chr Position (strand) Source MGSCv36 11 83,391,714 - 83,392,214 (-) MPROMDB
RGD ID: 8675910 Promoter ID: EPDNEW_M15986 Type: initiation region Name: Ccl9_1 Description: Mus musculus chemokine (C-C motif) ligand 9 , mRNA. SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Alternative Promoters: null; see alsoEPDNEW_M15987 Experiment Methods: Single-end sequencing. Position: Mouse Assembly Chr Position (strand) Source GRCm38 11 83,578,503 - 83,578,563 EPDNEW
RGD ID: 8675926 Promoter ID: EPDNEW_M15987 Type: initiation region Name: Ccl9_2 Description: Mus musculus chemokine (C-C motif) ligand 9 , mRNA. SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Alternative Promoters: null; see alsoEPDNEW_M15986 Experiment Methods: Single-end sequencing. Position: Mouse Assembly Chr Position (strand) Source GRCm38 11 83,578,633 - 83,578,693 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2023-07-04
Ccl9
C-C motif chemokine ligand 9
Ccl9
chemokine (C-C motif) ligand 9
Symbol and/or name change
5135510 APPROVED
