D5Rat98 Marker Search Result - Rat Genome Database

Advanced Search (OLGA)

General

Marker: D5Rat98

Symbol:

D5Rat98

Previously known as:

oxsts7248; R0085-D01;

RGD ID:

39224

Expected Size:

205 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
GRCr8	5	100,820,198 - 100,820,403 (+)	Marker Load Pipeline
mRatBN7.2	5	95,774,194 - 95,774,399 (+)	MAPPER	mRatBN7.2
Rnor_6.0	5	99,421,434 - 99,421,638	NCBI	Rnor6.0
Rnor_5.0	5	103,451,053 - 103,451,257	UniSTS	Rnor5.0
RGSC_v3.4	5	100,017,060 - 100,017,265	RGD	RGSC3.4
RGSC_v3.4	5	100,017,061 - 100,017,265	UniSTS	RGSC3.4
Celera	5	94,344,392 - 94,344,614	UniSTS
RGSC_v3.1	5	100,022,287 - 100,022,491	RGD
RH 3.4 Map	5	724.1	UniSTS
RH 3.4 Map	5	724.1	RGD
RH 2.0 Map	5	603.7	RGD
SHRSP x BN Map	5	53.5899	RGD
Cytogenetic Map	5	q31	UniSTS

Is Marker For:

Strains: ACI/N ; AVN/Orl ; BBDR/Rhw ; BBDP/Rhw ; BC/CpbU ; BDIX/Han ; BDVII/Cub ; BN-Lx/Cub ; BN/SsNHsd ; BP/Cub ; BUF/Pit ; COP/OlaHsd ; DA/PitN ; FHH/Eur ; F344/Pit ; GH/Omr ; GK/KyoSwe ; DON/Melb ; M520/N ; IS/Kyo ; WN/N ; LH/Mav ; LE/Mol ; LEW/Pit ; LOU/CHan ; LN/Mav ; MHS/Gib ; MNR/N ; MNRA/N ; MNS/Gib ; MR/Pit ; NEDH/K ; NP9 ; ODU/N ; OKA/Wsl ; OM/Ztm ; P5C ; PVG/Pit ; SD/Rij ; SHR/OlaHsd ; SR/Jr ; SHRSP/Riv ; SS/Jr ; WAG/RijKyo ; WF/Pit ; WIST/Nhg ; WKY/OlaHsd ; WTC/Kyo ; ACI.BN-(D5Mgh17-D5Rat98)/Shul ; BBDR.LA-(D5Rat98-D5Rat233)/Rhw
Genes: Mpdz

Annotation

References - curated

#	Reference Title	Reference Citation
1.	Data downloaded from Wellcome Trust, University of Oxford	Data downloaded from Wellcome Trust, University of Oxford
2.	High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence.	Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3.	Rat Genetic Map Data	Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4.	Electronic Transfer of SSLP Data	Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5.	UniSTS Pipeline	RGD automated pipelines
6.	RH Map Project	RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7.	A high density integrated genetic linkage and radiation hybrid map of the laboratory rat	Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence


Forward Primer	ACACTGTGGCCTCCAAATTC
Reverse Primer	ACCCAATGCCAGTCCATAAA

Template	TCCGATCTAGAGGATCCCCTCTCCTGACCTCAAGCCTGGCATCTCGGGGAAACACTCTGATTTT GTTGCATGCTTAACTAGCCACATTTTTTTTATTGGTTTCTCTAGTGGTCTGTCCAATGTGCCAC AGGCTTGACTATGGGTAAGCAAAGCACTAGAAAGGATCCTATCAATGTTTTCTTGCCTGTCAGT ACCACTGTCCCAGCCACAGTGATGTCCATAGTTGAACAGCATTAGAAGAGTCAGCCTTTACTGA AGCATTCAGTGAGTGAAGAGAACCCAATGCCAGTCCATAAATGGTCTTTATGAACAGACTCATG AAAATAGGTTTCTGTCATCAGATGATAATGCTGAGAAGAAAGGCTTGCCACAAATCATGCACTT GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGNGTGTGTGTGTTTGTATG TATGTGTAGGAGGTCTACATCTGCATATAATCATGCATGAATTTGGAGGCCACAGTGTACTAGA TACTCCTCAGAGCACCACTTGGTTCTGAGCAGGTNCCATGGGACTGGGANGCCATGTGGTTAGC TATAGTGATGNCATGGCACGCAATGTGTTNCGAGGAANGAGAATTCAAAGTCTGACAGGACGNC AAATAGCTGNNCATAGAGGAAGTCATATTTGAGCCAGCCCTNCCCTNCACNCATNCAGTTCNCN NCGACTACGNTCNCACCTANCTCACTTNCGNGNTNTNNCNAANNNGCNNTNNACNNGNNNC

Strain Variation

Strain, Expected Size(s)

ACI/N	196
AVN/Orl	196
BBDP/Rhw	196
BBDR/Rhw	196
BC/CpbU	196
BDIX/Han	196
BDVII/Cub	222
BN-Lx/Cub	220
BN/SsNHsd	204
BP/Cub	222
BUF/Pit	222
COP/OlaHsd	196
DA/PitN	196

DON/Melb	206
F344/Pit	206
FHH/Eur	196
GH/Omr	222
GK/KyoSwe	196
IS/Kyo	212
LE/Mol	196
LEW/Pit	196
LH/Mav	222
LN/Mav	222
LOU/CHan	196
M520/N	196
MHS/Gib	196

MNR/N	196
MNRA/N	196
MNS/Gib	196
MR/Pit	196
NEDH/K	196
NP9	196
ODU/N	228
OKA/Wsl	228
OM/Ztm	222
P5C	196
PVG/Pit	196
SD/Rij	198
SHR/OlaHsd	196

SHRSP/Riv	196
SR/Jr	222
SS/Jr	222
WAG/RijKyo	196
WF/Pit	196
WIST/Nhg	196
WKY/OlaHsd	228
WN/N	196
WTC/Kyo	228

Region

Genes in Region

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
3105	Mpdz	multiple PDZ domain crumbs cell polarity complex component	5	100812121	100966566	Rat

Nucleotide Sequences


GenBank Nucleotide	CH473978	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CM000235	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (GRCr8)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1357396	Bw44	Body weight QTL 44	4.19		body mass (VT:0001259)	body weight (CMO:0000012)	5	73779642	118779642	Rat
1549845	Scl44	Serum cholesterol level QTL 44	6		blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	5	44924861	153890773	Rat
61380	Edpm5	Estrogen-dependent pituitary mass QTL 5	4.5	0.92	pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	5	73779642	103472210	Rat
70212	Niddm25	Non-insulin dependent diabetes mellitus QTL 25	3.54		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	5	38207390	136631402	Rat
1298070	Scl18	Serum cholesterol level QTL 18	3.7		blood LDL cholesterol amount (VT:0000181)	calculated plasma low density lipoprotein cholesterol level (CMO:0001245)	5	84630798	129630798	Rat
61386	Bp49	Blood pressure QTL 49	16.6		cerebrum integrity trait (VT:0010549)	brain infarction volume (CMO:0001013)	5	65089051	103648916	Rat
61452	Ciaa5	CIA Autoantibody QTL 5	3.5		blood autoantibody amount (VT:0003725)	calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)	5	99905133	172190305	Rat
1331801	Rf33	Renal function QTL 33	4.149		kidney blood vessel physiology trait (VT:0100012)	absolute change in renal vascular resistance (CMO:0001900)	5	48523123	134369373	Rat
2302381	Bw84	Body weight QTL 84	4.47		body mass (VT:0001259)	body mass index (BMI) (CMO:0000105)	5	73779642	118779642	Rat
1357402	Bw46	Body weight QTL 46	4.47		body mass (VT:0001259)	body mass index (BMI) (CMO:0000105)	5	73779642	118779642	Rat
7411582	Foco3	Food consumption QTL 3	7.5	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	5	92583776	137583776	Rat
61393	Bp7	Blood pressure QTL 7	4.5	0.0001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	5	65089051	166764498	Rat
1331782	Rf36	Renal function QTL 36	3.296		kidney blood vessel physiology trait (VT:0100012)	absolute change in renal blood flow rate (CMO:0001168)	5	39019942	102105896	Rat
1598859	Cm66	Cardiac mass QTL 66	2		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	5	84630798	129630798	Rat
1578766	Tcas11	Tongue tumor susceptibility QTL 11	4.12		tongue integrity trait (VT:0010553)	number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)	5	51657967	166600247	Rat
7411564	Bw135	Body weight QTL 135		0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	5	92583776	137583776	Rat
8657050	Bw146	Body weight QTL 146	19.84	0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	5	98972960	143972960	Rat
1576312	Emca8	Estrogen-induced mammary cancer QTL 8	4.1		mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	55124766	172190305	Rat
7411601	Foco12	Food consumption QTL 12	19.7	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	5	92583776	137583776	Rat
7394708	Emca11	Estrogen-induced mammary cancer QTL 11			mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	73176602	118176602	Rat
1598846	Bp293	Blood pressure QTL 293	3.9		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	5	84630798	129630798	Rat
7394710	Emca12	Estrogen-induced mammary cancer QTL 12			mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	94034903	139034903	Rat
1578673	Bmd13	Bone mineral density QTL 13	4.9		femur mineral mass (VT:0010011)	trabecular volumetric bone mineral density (CMO:0001729)	5	69474415	114474415	Rat
1358909	Kidm25	Kidney mass QTL 25	1.87		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	5	95062526	133270832	Rat
70189	Mcs5	Mammary carcinoma susceptibility QTL 5	10.51		mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	60601597	137492949	Rat
61359	Eaex	Experimental allergic encephalomyelitis QTL x	3		nervous system integrity trait (VT:0010566)	post-insult time to onset of experimental autoimmune encephalomyelitis (CMO:0001422)	5	60511627	105511627	Rat
2290448	Scl54	Serum cholesterol level QTL 54	2.93		blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	5	36460764	136631402	Rat
61426	Scl2	Serum cholesterol level QTL 2	7.3	0.001	blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	5	64589016	109589016	Rat
1354598	Srn6	Serum renin concentration QTL 6	3.8		blood renin amount (VT:0003349)	plasma renin activity level (CMO:0000116)	5	74335621	156302135	Rat
1600362	Mcs19	Mammary carcinoma susceptibility QTL 19	2.5		mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	82032155	127032155	Rat
1298086	Bp156	Blood pressure QTL 156			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	5	89369373	134369373	Rat
2290005	Mcs24	Mammary carcinoma susceptibility QTL 24			mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	5	69835120	114835120	Rat
2306971	Anxrr21	Anxiety related response QTL 21	9.47		fear/anxiety-related behavior trait (VT:1000241)	number of entries into a discrete space in an experimental apparatus (CMO:0000960)	5	70969494	136328156	Rat
1358895	Bp254	Blood pressure QTL 254	3.6	0.0003	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	5	97492524	133270832	Rat
2316959	Gluco59	Glucose level QTL 59	4.7		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	5	56546393	101546393	Rat
2312671	Scl64	Serum cholesterol level QTL 64		0.001	blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	5	73779642	118779642	Rat
6903316	Bw113	Body weight QTL 113	2	0.0103	body mass (VT:0001259)	body weight (CMO:0000012)	5	92881678	137881678	Rat
1358889	Bp261	Blood pressure QTL 261	2.86		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	5	95062526	133270832	Rat

Additional Information

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	29365	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: D5Rat98