D20Mit4 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Marker: D20Mit4

Symbol: D20Mit4
Previously known as: R818; R1103-D03; oxsts9020; 
RGD ID: 33876
Expected Size: 202 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr82033,724,392 - 33,724,594 (+)Marker Load Pipeline
Rnor_5.02035,793,251 - 35,793,452NCBIRnor5.0
Rnor_5.02036,923,764 - 36,923,964NCBIRnor5.0
Rnor_5.02036,993,798 - 36,993,999NCBIRnor5.0
Rnor_5.02035,793,252 - 35,793,452NCBIRnor5.0
Rnor_5.02036,993,799 - 36,993,999NCBIRnor5.0
Rnor_5.02036,923,763 - 36,923,964NCBIRnor5.0
RGSC_v3.42032,560,484 - 32,560,683UniSTSRGSC3.4
RGSC_v3.42032,560,483 - 32,560,683RGDRGSC3.4
Celera2034,574,289 - 34,574,502UniSTS
RGSC_v3.12032,574,270 - 32,574,620RGD
SHRSP x BN Map2022.43RGD
SHRSP x BN Map2022.43UniSTS
FHH x ACI Map2015.7299RGD
Cytogenetic Map20 RGD
Is Marker For: Strains:   ACI/N ; AVN/Orl ; BBDR/Rhw ; BBDP/Rhw ; BC/CpbU ; BDIX/Han ; BDVII/Cub ; BN-Lx/Cub ; BN/SsNHsd ; BP/Cub ; BUF/Pit ; COP/OlaHsd ; DA/PitN ; FHH/Eur ; F344/Pit ; GH/Omr ; GK/KyoSwe ; DON/Melb ; M520/N ; IS/Kyo ; WN/N ; LH/Mav ; LE/Mol ; LEW/Pit ; LN/Mav ; MHS/Gib ; MNR/N ; MNRA/N ; MNS/Gib ; MR/Pit ; NEDH/K ; NP9 ; ODU/N ; OKA/Wsl ; OM/Ztm ; P5C ; PVG/Pit ; SD/Rij ; SHR/OlaHsd ; SR/Jr ; SHRSP/Riv ; SS/Jr ; WAG/RijKyo ; WF/Pit ; WIST/Nhg ; WKY/OlaHsd ; WTC/Kyo ; DA.F344-Aia1/1
QTLs:   Colcr9  


Annotation



Strains and Sequence

Sequence
 
Forward Primer TAAATTCAGAGTGTTGTTCCTGC
Reverse Primer CACACCCAATGAATGCTCTG
 

Region

Nucleotide Sequences
GenBank Nucleotide JH619658.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
4889610Pancm3Pancreatic morphology QTL 33.750.001pancreas mass (VT:0010144)pancreas wet weight (CMO:0000626)20418947649189476Rat
2303587Bw93Body weight QTL 9313body mass (VT:0001259)body weight (CMO:0000012)202668936256021148Rat
1641915Colcr9Colorectal carcinoma resistance QTL 92.970.0024intestine integrity trait (VT:0010554)benign colorectal tumor number (CMO:0001795)20133724594Rat
7411668Foco32Food consumption QTL 3280.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)20136600300Rat
2305926Iddm37Insulin dependent diabetes mellitus QTL 376blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)20153308346533083Rat
1558640Prcs2Prostate cancer susceptibility QTL 23.3prostate integrity trait (VT:0010571)percentage of study population developing ventral prostate tumorous lesions during a period of time (CMO:0000943)20134066551Rat
2303626Vencon10Ventilatory control QTL 100.001respiration trait (VT:0001943)respiration rate (CMO:0000289)202074558556021148Rat
1598869Memor6Memory QTL 63.1exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)202668936256021148Rat
1598870Bp289Blood pressure QTL 2892.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)20821635953216359Rat
70158Bp60Blood pressure QTL 603arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)203215696745978663Rat
1598858Cm61Cardiac mass QTL 613.6heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)20821635953216359Rat
1331747Hrtrt16Heart rate QTL 163.163heart pumping trait (VT:2000009)heart rate (CMO:0000002)202679235356021148Rat
1598816Memor12Memory QTL 122.4exploratory behavior trait (VT:0010471)average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)201224324249189476Rat
2303578Gluco50Glucose level QTL 502blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)202668936256021148Rat
9590252Scort12Serum corticosterone level QTL 1220.460.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)20136600300Rat
2300188Bmd68Bone mineral density QTL 686.40.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)202668936256021148Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 100303250 UniSTS