D17Arb4 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Marker: D17Arb4

Symbol: D17Arb4
Previously known as: oxsts7732; R0270-B11; 
RGD ID: 10119
Expected Size: 244 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr81734,434,111 - 34,434,355 (+)Marker Load Pipeline
mRatBN7.21734,225,481 - 34,225,872 (+)MAPPERmRatBN7.2
mRatBN7.21734,225,566 - 34,225,727 (+)MAPPERmRatBN7.2
mRatBN7.21734,225,481 - 34,225,727 (+)MAPPERmRatBN7.2
Rnor_6.01735,956,457 - 35,957,000NCBIRnor6.0
Rnor_6.01735,956,457 - 35,956,698NCBIRnor6.0
Rnor_5.01737,268,920 - 37,269,463UniSTSRnor5.0
Rnor_5.01737,268,920 - 37,269,161UniSTSRnor5.0
RGSC_v3.41740,683,664 - 40,683,905UniSTSRGSC3.4
RGSC_v3.41740,683,663 - 40,683,905RGDRGSC3.4
RGSC_v3.11740,686,504 - 40,686,746RGD
SHRSP x BN Map1726.9699UniSTS
SHRSP x BN Map1726.9699RGD
Cytogenetic Map17q12UniSTS
Is Marker For: Strains:   AVN/Orl ; BBDR/Rhw ; BBDP/Rhw ; BC/CpbU ; BN-Lx/Cub ; BN/SsNHsd ; BP/Cub ; BUF/Pit ; DA/PitN ; F344/Pit ; GH/Omr ; GK/KyoSwe ; DON/Melb ; M520/N ; IS/Kyo ; WN/N ; LE/Mol ; LEW/Pit ; LOU/CHan ; LN/Mav ; MHS/Gib ; MNR/N ; MNRA/N ; MNS/Gib ; NEDH/K ; NP9 ; ODU/N ; OKA/Wsl ; OM/Ztm ; P5C ; PVG/Pit ; SD/Rij ; SHR/OlaHsd ; SR/Jr ; SHRSP/Riv ; SS/Jr ; WAG/RijKyo ; WF/Pit ; WIST/Nhg ; WKY/OlaHsd ; WTC/Kyo
Genes:   Agtr1a  


Annotation



Strains and Sequence

Sequence
 
Forward Primer TGAGGTCTCATTTGGAAGTTGG
Reverse Primer TTTTGTTAGGGGCAATACAGGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
2070Agtr1aangiotensin II receptor, type 1a173438339734435523Rat

Nucleotide Sequences
GenBank Nucleotide M86911 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1354581Bp247Blood pressure QTL 2474.5arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)17143999106Rat
2300002Iddm36Insulin dependent diabetes mellitus QTL 361.98blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)17926675540968173Rat
70210Cm15Cardiac mass QTL 156.5heart right ventricle mass (VT:0007033)heart right ventricle wet weight (CMO:0000072)173006647275066472Rat
8552966Pigfal18Plasma insulin-like growth factor 1 level QTL 188.7blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)171286094257860942Rat
152023626Bp403Blood pressure QTL 4033.86arterial blood pressure trait (VT:2000000)172413612784432719Rat
1300123Bp194Blood pressure QTL 1942.82arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)17212084342054133Rat
9590107Sffal7Serum free fatty acids level QTL 74.810.001blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)173310464578104645Rat
2302377Scl61Serum cholesterol level QTL 614.36blood HDL cholesterol amount (VT:0000184)serum high density lipoprotein cholesterol level (CMO:0000361)17622199858177198Rat
70157Niddm32Non-insulin dependent diabetes mellitus QTL 324.34blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)172266079955604694Rat
9589151Insul30Insulin level QTL 308.820.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)171286094257860942Rat
724549Niddm56Non-insulin dependent diabetes mellitus QTL 560.03blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)173219953449497050Rat
1354628Stl13Serum triglyceride level QTL 133.8blood triglyceride amount (VT:0002644)blood triglyceride level (CMO:0000118)172149899450592236Rat
1581512Cm55Cardiac mass QTL 552.80.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)172723344583975845Rat
10054088Scort28Serum corticosterone level QTL 282.040.0102blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)17473353449733534Rat
61394Bp8Blood pressure QTL 82.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)172328632264246472Rat
9589057Scfw6Subcutaneous fat weight QTL 68.620.001subcutaneous adipose mass (VT:1000472)abdominal subcutaneous fat pad weight (CMO:0002069)171286094257860942Rat
2317045Aia11Adjuvant induced arthritis QTL 114.06joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)172652205171522051Rat
9590154Scort9Serum corticosterone level QTL 923.570.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)171286094257860942Rat
10450503Bp386Blood pressure QTL 3860.28arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)172201970567019705Rat
1559055Bp278Blood pressure QTL 2780.04arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)172385892668858926Rat
152025238Slep14Serum leptin concentration QTL 144.62blood leptin amount (VT:0005667)172439059584432719Rat
9590088Insglur7Insulin/glucose ratio QTL 720.380.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)171286094257860942Rat
2313854Bp343Blood pressure QTL 3433.9life span trait (VT:0005372)age at time of death (CMO:0001193)173219953455604694Rat
2317053Aia25Adjuvant induced arthritis QTL 252.69joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)171060469455604694Rat
1354613Kidm14Kidney mass QTL 146.2kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)17136045694Rat
1331765Hrtrt15Heart rate QTL 154.094heart pumping trait (VT:2000009)heart rate (CMO:0000002)171553702560531414Rat
8552928Pigfal9Plasma insulin-like growth factor 1 level QTL 99blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)173310464578104645Rat
7411666Foco31Food consumption QTL 3111.40.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)171286094257860942Rat
2303627Vencon8Ventilatory control QTL 80.001respiration trait (VT:0001943)tidal volume (CMO:0000222)17473353449733534Rat
12903980Cm120Cardiac mass QTL 1200.002heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)172385892668858926Rat
12903981Am17Aortic mass QTL 170.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)172385892668858926Rat
4889955Bss93Bone structure and strength QTL 934.4tibia size trait (VT:0100001)tibia cortical bone volume to tibia total bone volume ratio (CMO:0001727)172723344565155015Rat
4889891Eae32Experimental allergic encephalomyelitis QTL 324.80.0002nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)172723344572233445Rat
12903982Kidm70Kidney mass QTL 700.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)172385892668858926Rat
631207Niddm41Non-insulin dependent diabetes mellitus QTL 41blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)17138037084Rat
12903978Cm118Cardiac mass QTL 1180.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)172385892668858926Rat
12903979Cm119Cardiac mass QTL 1190.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)172385892668858926Rat
1354662Rf49Renal function QTL 492.9blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)17143999106Rat
152023740Bp406Blood pressure QTL 4066.06arterial blood pressure trait (VT:2000000)172413612784432719Rat
1354663Bvd5Brain ventricular dilatation QTL 53.510.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)173219953486201342Rat
7488966Bp370Blood pressure QTL 3700.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)172385892668858926Rat
1354658Spl8Serum phospholipid level QTL 83.8blood VLDL phospholipid amount (VT:0010507)blood very low density lipoprotein phospholipid level (CMO:0001571)17143999106Rat
152023737Bp405Blood pressure QTL 4055.06arterial blood pressure trait (VT:2000000)2413612784432719Rat
152023736Bp404Blood pressure QTL 4043.78arterial blood pressure trait (VT:2000000)172413612784432719Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 24180 UniSTS
NCBI Nucleotide M86911