D11Rat80 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D11Rat80

Symbol: D11Rat80
Previously known as: R0020-D08; oxsts9305; 
RGD ID: 35581
Expected Size: 167 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21110,853,326 - 10,853,485 (+)MAPPERmRatBN7.2
Rnor_6.0119,353,931 - 9,354,089NCBIRnor6.0
Rnor_5.01113,033,392 - 13,033,550UniSTSRnor5.0
RGSC_v3.41110,929,300 - 10,929,459RGDRGSC3.4
RGSC_v3.41110,929,301 - 10,929,459UniSTSRGSC3.4
RGSC_v3.11110,929,301 - 10,929,459RGD
Celera1110,738,560 - 10,738,718UniSTS
RH 3.4 Map1155.6UniSTS
RH 3.4 Map1155.6RGD
RH 2.0 Map11699.1RGD
Cytogenetic Map11p11UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
Genes:   Robo1  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer AAAATGAGTTTTGAGATGAGGGA
Reverse Primer TCCACATGACTTTGATCACAGA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
61941Robo1roundabout guidance receptor 1111058086311621675Rat

Nucleotide Sequences
GenBank Nucleotide CH474018 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000241 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
634341Bw121Body weight QTL 1213.56abdominal fat pad mass (VT:1000711)abdominal fat pad weight (CMO:0000088)11121836709Rat
1598842Glom10Glomerulus QTL 103.4kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)11135331169Rat
1300147Bp187Blood pressure QTL 1873.67arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)11169446234Rat
1558659Tescar1Testicular tumor resistance QTL 13.9testis integrity trait (VT:0010572)percentage of study population developing testis tumors during a period of time (CMO:0001261)11104193166113562Rat
1641927Alcrsp10Alcohol response QTL 10alcohol metabolism trait (VT:0015089)blood ethanol level (CMO:0000535)11843667453436674Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 58946 UniSTS
UniSTS 120795 UniSTS