Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Behavioral & Substance Use Disorder Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)
Genes search result for Rattus norvegicus
(View Results for all Objects and Ontologies)

16 records found for search term shr
Refine Term:
Assembly:
    Chr  
Sort By:
           Export CSV TAB Print GViewer Analysis Tools

RGD IDSymbolNameDescriptionChrStartStopSpeciesAnnotationsMatchType
2592Fabp6fatty acid binding protein 6ENCODES a protein that exhibits fatty acid binding; INVOLVED IN steroid metabolic process; PARTICIPATES IN eicosanoid signaling pathway via peroxisome proliferator-activated receptor gamma; FOUND IN cytoplasm (inferred); membrane (inferred); INTERACTS WITH 1,1,1-trichloro-2,2-bis(4-hydroxyphenyl)eth102856505428569727Rat94old_gene_namegene, protein-coding, PROVISIONAL [RefSeq]
1308066Shroom1shroom family member 1ENCODES a protein that exhibits actin filament binding (ortholog); myosin II binding (ortholog); INVOLVED IN actin filament bundle assembly (ortholog); cell morphogenesis (ortholog); ASSOCIATED WITH COVID-19 (ortholog); FOUND IN cytoskeleton (inferred); microtubule (inferred); INTERACTS WITH 17beta-103812197138134832Rat85symbol , PhenoGen , namegene, protein-coding, MODEL [RefSeq]
1565163Shroom2shroom family member 2ENCODES a protein that exhibits actin binding (ortholog); actin filament binding (ortholog); beta-catenin binding (ortholog); INVOLVED IN actin filament bundle assembly (ortholog); cell migration (ortholog); cell morphogenesis (ortholog); ASSOCIATED WITH Meniere's disease (ortholog); FOUND IN adhereX2530816325480194Rat127symbol , PhenoGen , namegene, protein-coding, VALIDATED [RefSeq]
1310470Shroom3shroom family member 3ENCODES a protein that exhibits actin binding (ortholog); INVOLVED IN actin cytoskeleton organization (ortholog); columnar/cuboidal epithelial cell development (ortholog); neural tube closure (ortholog); ASSOCIATED WITH tetralogy of Fallot (ortholog); FOUND IN adherens junction (ortholog); apical ju141538376915681158Rat117symbol , old_gene_name , PhenoGen , name , old_gene_symbolgene, protein-coding, PROVISIONAL [RefSeq]
1563434Shroom4shroom family member 4ENCODES a protein that exhibits actin filament binding (ortholog); myosin II binding (ortholog); INVOLVED IN regulation of postsynaptic membrane neurotransmitter receptor levels; actin filament organization (ortholog); brain development (ortholog); ASSOCIATED WITH intellectual disability (ortholog);X1853737118748665Rat93symbol , PhenoGen , namegene, protein-coding, PROVISIONAL [RefSeq]
14394503Klrb1aem1Mcwikiller cell lectin-like receptor subfamily B, member 1A; CRISPR/Cas9 induced mutant 1, McwiCRISPR/Cas9 system was used to introduce a 5-bp deletion in exon 2 in SHR/NCrl embryos.Ratdescriptiongene, allele
14394505Klrb1aem2Mcwikiller cell lectin-like receptor subfamily B, member 1A; CRISPR/Cas9 induced mutant 2, McwiCRISPR/Cas9 system was used to introduce a 102-bp deletion in exon 2 in SHR/NCrl embryos.Ratdescriptiongene, allele
149735372C3em1Kyocomplement C3; ZFN induced mutant 1, KyoZFN constructs specific for the rat C3 gene were designed to target bases 1803-1841 (NCBI reference sequence: NM_016994) of C3 (target sequence: cagggggcccgagtgggctagtggctgtggacaagggg) by Sigma-Aldrich (Tokyo, Japan). The ZFN systems were injected into the pronucleus of SHRRatdescriptiongene, allele
19259465Camk2n1em1Tjacalcium/calmodulin-dependent protein kinase II inhibitor 1; ZFN induced mutant 1, TjaINVOLVED IN positive regulation of insulin secretion involved in cellular response to glucose stimulus; positive regulation of systemic arterial blood pressure; ASSOCIATED WITH decreased brown adipose tissue mass; decreased epididymal fat pad weight; decreased heart left ventricle weightRat9descriptiongene, allele
127285405Cfbem1Tjacomplement factor B, ZFN induced mutant 1, TjaASSOCIATED WITH decreased brown adipose tissue amount; decreased circulating aldosterone level; decreased circulating cholesterol levelRat13descriptiongene, allele
12791992Gja8m1Cubgap junction protein, alpha 8; mutant 1 CubASSOCIATED WITH abnormal lens capsule morphology; abnormal lens development; abnormal lens epithelium morphology; ASSOCIATED WITH cataract; cataract 1 multiple types; microphthalmiaRat34descriptiongene, allele
10002755Sbf1m1IpcvSET binding factor 1; mutation 1, Institute of Physiology, Czechoslovac Academy of SciencesASSOCIATED WITH arrest of spermiogenesis; azoospermia; decreased testis weightRat4descriptiongene, allele
150340624Zbtb16em1Ipcvzinc finger and BTB domain containing 16; TALEN induced mutant 1, IpcvASSOCIATED WITH cardiac interstitial fibrosis; decreased body weight; decreased circulating cholesterol levelRat10descriptiongene, allele
12910834Zbtb16Lxzinc finger and BTB domain containing 16, Lx mutantASSOCIATED WITH preaxial polydactyly; ASSOCIATED WITH polydactylyRat2descriptiongene, allele
1590138Ajap1adherens junctions associated protein 1ENCODES a protein that exhibits beta-catenin binding (ortholog); protein domain specific binding (ortholog); protein-containing complex binding (ortholog); INVOLVED IN negative regulation of cell-matrix adhesion (ortholog); negative regulation of wound healing (ortholog); regulation of polarized epi5169190477169302938Rat89old_gene_namegene, protein-coding, PROVISIONAL [RefSeq]
13792814Spp1em2Mcwisecreted phosphoprotein 1; CRISPR/Cas9 induced mutant 2, McwiCRISPR/Cas9 system was used to introduce a mutation in the Spp1 gene of SHRSP/A3NCrl rat embryos. The resulting mutation is a 11-bp deletion in Exon 3 of the Spp1 gene.Ratdescriptiongene, allele