Apex1 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: Apex1

Symbol: Apex1
Previously known as:
RGD ID: 5505175
Expected Size: 183 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2416,445,834 - 16,446,017 (+)MAPPERmRatBN7.2
Rnor_6.0416,748,761 - 16,748,943NCBIRnor6.0
Rnor_6.0413,041,009 - 13,041,191NCBIRnor6.0
Rnor_5.0413,026,098 - 13,026,280UniSTSRnor5.0
Rnor_5.0416,724,810 - 16,724,992UniSTSRnor5.0
RGSC_v3.4412,044,915 - 12,045,097UniSTSRGSC3.4
Celera411,978,191 - 11,978,373UniSTS
Cytogenetic Map4q11UniSTS
Is Marker For: Genes:   LOC688436   Apex1-ps2  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GCTCTTGCAGTTCAGCCG
Reverse Primer ATCAGAAAACCTCACCCAGTG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
6497775Apex1-ps2apurinic/apyrimidinic endodeoxyribonuclease 1, pseudogene 241644519516446152Rat

Nucleotide Sequences
GenBank Nucleotide AB023066 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH614468.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2302371Stl22Serum triglyceride level QTL 225.15blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4521829457114705Rat
2303585Bw86Body weight QTL 864body mass (VT:0001259)body weight (CMO:0000012)41467806559678065Rat
8552903Pigfal2Plasma insulin-like growth factor 1 level QTL 27.3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)4131934116Rat
724557Plsm1Polydactyly-luxate syndrome (PLS) morphotypes QTL 10.0003forelimb integrity trait (VT:0010562)front foot phalanges count (CMO:0001947)4127716890Rat
9590100Sffal4Serum free fatty acids level QTL 47.360.05blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)4131934116Rat
8552906Pigfal3Plasma insulin-like growth factor 1 level QTL 3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)41008408955084089Rat
1357341Gluco5Glucose level QTL 56.4adipocyte free fatty acid secretion trait (VT:0010465)absolute change in adipocyte free fatty acid secretion per unit volume (CMO:0001446)4133250345Rat
1357343Gluco4Glucose level QTL 40.00002adipocyte glucose uptake trait (VT:0004185)adipocyte maximal glucose uptake to basal glucose uptake ratio (CMO:0000874)4133250345Rat
6478766Anxrr47Anxiety related response QTL 470.09637locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)41008408955084089Rat
631642Stl2Serum triglyceride level QTL 23.3blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4521917856647776Rat
6478769Anxrr48Anxiety related response QTL 480.02514locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)41008408955084089Rat
631261Tcas3Tongue tumor susceptibility QTL 36.88tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)41081417091360527Rat
61333Gluco16Glucose level QTL 164.30.00001adipocyte glucose uptake trait (VT:0004185)absolute change in adipocyte glucose uptake (CMO:0000873)4130372989Rat
634323Hc2Hypercalciuria QTL 22.15urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)421079645210796Rat
61408Scl23Serum cholesterol level QTL 230.0005blood HDL phospholipid amount (VT:0010504)serum high density lipoprotein phospholipid level (CMO:0001567)4127716890Rat
631209Bw2Body weight QTL24.2retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)4994088544463908Rat
8694374Bw155Body weight QTL 1553.390.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)41008408955084089Rat
2303168Bp330Blood pressure QTL 3304.250.017arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)45214602146446691Rat
9589046Scfw2Subcutaneous fat weight QTL 25.540.001subcutaneous adipose mass (VT:1000472)abdominal subcutaneous fat pad weight (CMO:0002069)4131934116Rat
6478724Anxrr35Anxiety related response QTL 350.00449defecation behavior trait (VT:0010462)defecation measurement (CMO:0000997)41008408955084089Rat
61351Bp33Blood pressure QTL 330.0018arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)4127716890Rat
61415Eae11Experimental allergic encephalomyelitis QTL 112.9nervous system integrity trait (VT:0010566)post-insult time to onset of experimental autoimmune encephalomyelitis (CMO:0001422)4139505420Rat
1641905Colcr1Colorectal carcinoma resistance QTL 14.30.0003intestine integrity trait (VT:0010554)benign colorectal tumor surface area measurement (CMO:0001799)4129494328Rat
619616Bp79Blood pressure QTL 790.0292arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)4521460278882945Rat
1358201Gluco12Glucose level QTL121.6adipocyte glucose uptake trait (VT:0004185)adipocyte maximal glucose uptake (CMO:0000870)4521839229593287Rat
738021Hcar13Hepatocarcinoma resistance QTL 134.3liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464)4132584199Rat
1358203Stl19Serum triglyceride level QTL 192.80.002blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4521829465958103Rat
9590304Scort17Serum corticosterone level QTL 174.960.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)41008408955084089Rat
9589097Slep11Serum leptin concentration QTL 115.090.001blood leptin amount (VT:0005667)plasma leptin level (CMO:0000781)4131934116Rat
2316958Gluco58Glucose level QTL 5810blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)411320076180699135Rat
1300141Bp178Blood pressure QTL 178arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)41002490139524530Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100910631 UniSTS
  688436 UniSTS