UniSTS:235786 Marker Search Result

Advanced Search (OLGA)

General

Marker: UniSTS:235786

Symbol:

UniSTS:235786

Previously known as:

RGD ID:

5499955

Expected Size:

252 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	1	182,223,610 - 182,223,862 (+)	MAPPER	mRatBN7.2
Rnor_6.0	1	199,058,542 - 199,058,793	NCBI	Rnor6.0
Rnor_5.0	1	206,081,189 - 206,081,440	UniSTS	Rnor5.0
RGSC_v3.4	1	186,897,101 - 186,897,352	UniSTS	RGSC3.4
Celera	1	179,875,420 - 179,875,671	UniSTS
Cytogenetic Map	1	q36	UniSTS

Is Marker For:

Genes: Zfp629

#	Reference Title	Reference Citation
1.	UniSTS Pipeline	RGD automated pipelines


Forward Primer	GATCGTGGGTGAGAACCACT
Reverse Primer	CAAGTCAGTGCCCAGCTGTA

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
1306257	Zfp629	zinc finger protein 629	1	182217499	182258585	Rat


RefSeq Transcripts	NM_001107551.2	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	XM_003753338.1	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AY589489	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1578778	Pur4	Proteinuria QTL 4	3.3	0.003	urine total protein amount (VT:0000032)	urine total protein excretion rate (CMO:0000756)	1	150700247	252085048	Rat
1354646	Kidm18	Kidney mass QTL 18	5.7		kidney mass (VT:0002707)	calculated kidney weight (CMO:0000160)	1	151162512	256448636	Rat
1578780	Cm52	Cardiac mass QTL 52	3.3	0.0001	heart mass (VT:0007028)	heart wet weight (CMO:0000069)	1	81591954	219808434	Rat
1354652	Kidm20	Kidney mass QTL 20	4.3		kidney mass (VT:0002707)	calculated kidney weight (CMO:0000160)	1	177227632	256448636	Rat
2302378	Insul11	Insulin level QTL 11	3.25		blood insulin amount (VT:0001560)	serum insulin level (CMO:0000358)	1	144267353	251128347	Rat
1354653	Despr9	Despair related QTL 9		0.00019	locomotor behavior trait (VT:0001392)	amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)	1	167909849	212909849	Rat
1578770	Stresp23	Stress response QTL 23			kidney sympathetic nerve activity (VT:0004050)	stimulated renal sympathetic nerve activity to basal renal sympathetic nerve activity ratio (CMO:0001786)	1	123350408	182418476	Rat
2293673	Bss27	Bone structure and strength QTL 27	18.63	0.0001	femur morphology trait (VT:0000559)	femur midshaft cortical cross-sectional area (CMO:0001663)	1	171629477	216629477	Rat
2293677	Bss41	Bone structure and strength QTL 41	9.38	0.0001	lumbar vertebra size trait (VT:0010518)	lumbar vertebra cross-sectional area (CMO:0001689)	1	171629477	216629477	Rat
1302787	Stl25	Serum triglyceride level QTL 25	2.7	0.0073	blood triglyceride amount (VT:0002644)	plasma triglyceride level (CMO:0000548)	1	180359209	210702199	Rat
70160	Bw18	Body weight QTL 18	5.7		body mass (VT:0001259)	body weight (CMO:0000012)	1	144267353	196383668	Rat
1549830	Bss1	Bone structure and strength QTL 1	4.8		femur strength trait (VT:0010010)	femur ultimate force (CMO:0001675)	1	172609619	217609619	Rat
7794788	Mcs32	Mammary carcinoma susceptibility QTL 32	2.61		mammary gland integrity trait (VT:0010552)	mammary tumor incidence/prevalence measurement (CMO:0000946)	1	115540693	238914717	Rat
70163	Bw20	Body weight QTL 20	5.1		body mass (VT:0001259)	body weight (CMO:0000012)	1	174133260	219133260	Rat
1578763	Kidm29	Kidney mass QTL 29	3.3	0.0001	kidney mass (VT:0002707)	both kidneys wet weight (CMO:0000085)	1	179567751	260522016	Rat
1354624	Cm35	Cardiac mass QTL35	5.7		heart left ventricle mass (VT:0007031)	calculated heart weight (CMO:0000073)	1	177227632	256448636	Rat
1558658	Bw59	Body weight QTL 59	3.5	0.0003	body mass (VT:0001259)	body weight (CMO:0000012)	1	178784622	223784622	Rat
1354636	Lmblg1	Limb length QTL 1	6.4		tibia length (VT:0004357)	tibia length (CMO:0000450)	1	151162512	201278233	Rat
1549837	Hcar15	Hepatocarcinoma resistance QTL 15		0.05	liver integrity trait (VT:0010547)	liver tumorous lesion number (CMO:0001068)	1	153136852	260522016	Rat
2293689	Bss47	Bone structure and strength QTL 47	7.25	0.0001	lumbar vertebra size trait (VT:0010518)	lumbar vertebra trabecular cross-sectional area (CMO:0001692)	1	171629477	216629477	Rat
152025235	Bw194	Body weight QTL 194	4.86		body mass (VT:0001259)		1	123556856	242907031	Rat
1598853	Memor3	Memory QTL 3	4.5		exploratory behavior trait (VT:0010471)	total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)	1	143506580	212458660	Rat
61341	Bp26	Blood pressure QTL 26			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	169537671	214537671	Rat
1354634	Kidm12	Kidney mass QTL 12	3.9		kidney mass (VT:0002707)	right kidney wet weight (CMO:0000082)	1	151162512	201278233	Rat
4889428	Stresp24	Stress response QTL 24		0.05	heart pumping trait (VT:2000009)	absolute change in electrocardiographic low frequency R-R spectral component to high frequency R-R spectral component ratio (CMO:0002162)	1	155866514	200866514	Rat
152025232	Bw192	Body weight QTL 192	3.93		body mass (VT:0001259)		1	117917486	196963478	Rat
1578759	Uae30	Urinary albumin excretion QTL 30	3.3	0.003	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	1	150700247	252085048	Rat
61343	Bp28	Blood pressure QTL 28			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	151646613	196646613	Rat
2293693	Bss22	Bone structure and strength QTL 22	33.52	0.0001	femur morphology trait (VT:0000559)	femur cross-sectional area (CMO:0001661)	1	171629477	216629477	Rat
2300161	Bmd43	Bone mineral density QTL 43	8.4	0.0001	femur mineral mass (VT:0010011)	volumetric bone mineral density (CMO:0001553)	1	171629477	216629477	Rat
61347	Bp197	Blood pressure QTL 197	4.2		arterial blood pressure trait (VT:2000000)	blood pressure measurement (CMO:0000003)	1	158633083	203633083	Rat
61348	Bp30	Blood pressure QTL 30	2.4		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	144017057	197814409	Rat
8655649	Arrd1	Age-related retinal degeneration QTL 1	4.89		retinal layer morphology trait (VT:0003727)	percentage of study population developing retinopathy during a period of time (CMO:0002453)	1	100357752	183970443	Rat
2303622	Vencon6	Ventilatory control QTL 6		0.001	respiration trait (VT:0001943)	respiration rate (CMO:0000289)	1	154561505	199561505	Rat
631214	Bw61	Body weight QTL61	3.4	0.0001	intramuscular adipose amount (VT:0010044)	intramuscular fat area (CMO:0001162)	1	173108781	218108781	Rat
7771612	Cm80	Cardiac mass QTL 80	8.4		heart left ventricle mass (VT:0007031)	heart left ventricle weight (CMO:0000776)	1	149448574	221264292	Rat
731168	Bp154	Blood pressure QTL 154	3.4		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	94642644	214537671	Rat
631205	Bp196	Blood pressure QTL 196	4	0.0001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	118944897	199050459	Rat
1300158	Bp173	Blood pressure QTL 173	3.48		arterial blood pressure trait (VT:2000000)	blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)	1	115540693	185145286	Rat
2300174	Bmd42	Bone mineral density QTL 42	8.4	0.0001	lumbar vertebra mineral mass (VT:0010511)	bone mineral density (CMO:0001226)	1	171629477	216629477	Rat
737828	Hcas3	Hepatocarcinoma susceptibility QTL 3	4.9		liver integrity trait (VT:0010547)	liver tumorous lesion volume to total liver volume ratio (CMO:0001082)	1	144267353	222987745	Rat
1331749	Hrtrt11	Heart rate QTL 11	2.973		heart pumping trait (VT:2000009)	heart rate (CMO:0000002)	1	94494440	198211706	Rat
1354661	Bw33	Body weight QTL 33	5.2		body mass (VT:0001259)	body weight (CMO:0000012)	1	151162512	256448636	Rat
1358886	Bp260	Blood pressure QTL 260	3.67		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	151162766	225824951	Rat
737977	Bp160	Blood pressure QTL 160		0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	181133855	226133855	Rat
2293654	Bss30	Bone structure and strength QTL 30	32.65	0.0001	femur strength trait (VT:0010010)	femur midshaft polar moment of inertia (CMO:0001669)	1	171629477	216629477	Rat
724531	Uae5	Urinary albumin excretion QTL 5	4		urine albumin amount (VT:0002871)	urine albumin level (CMO:0000130)	1	150700142	252085212	Rat
2300187	Bmd41	Bone mineral density QTL 41	8.9	0.0001	femur mineral mass (VT:0010011)	volumetric bone mineral density (CMO:0001553)	1	171629477	216629477	Rat
1641895	Bp298	Blood pressure QTL 298			arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	123350408	182418476	Rat
70209	Niddm23	Non-insulin dependent diabetes mellitus QTL 23	2.82		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	1	94494440	198324465	Rat
1354580	Scort1	Serum corticosterone level QTL 1	3.4		blood corticosterone amount (VT:0005345)	blood corticosterone level (CMO:0001172)	1	156677124	256448636	Rat
1358294	Bw37	Body weight QTL 37	5	0.000011	body mass (VT:0001259)	body weight (CMO:0000012)	1	171310381	216310381	Rat
61378	Bp43	Blood pressure QTL 43	22.6		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	181746937	196383668	Rat
634314	Niddm44	Non-insulin dependent diabetes mellitus QTL 44			blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	1	49393289	199050459	Rat
724559	Pancm1	Pancreatic morphology QTL 1	7.1		islet of Langerhans morphology trait (VT:0005215)	pancreatic islet damage composite score (CMO:0001156)	1	181759564	214537555	Rat
2312420	Pur17	Proteinuria QTL 17	7.1	0.0001	urine protein amount (VT:0005160)	urine total protein excretion rate (CMO:0000756)	1	156677124	218753816	Rat
10059600	Bp378	Blood pressure QTL 378	3.08	0.05	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	176869060	221869060	Rat
1354591	Cm36	Cardiac mass QTL 36	4.1		heart left ventricle mass (VT:0007031)	calculated heart weight (CMO:0000073)	1	102813953	201278233	Rat
2312558	Glom17	Glomerulus QTL 17	3.9	0.001	kidney glomerulus morphology trait (VT:0005325)	index of glomerular damage (CMO:0001135)	1	166532971	191278129	Rat
7421630	Bp362	Blood pressure QTL 362		0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	118608292	241799120	Rat
10059597	Bp377	Blood pressure QTL 377	3.42	0.025	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	32737458	199368955	Rat
619613	Bp77	Blood pressure QTL 77		0.01	arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	1	164747424	209747424	Rat
619614	Bp78	Blood pressure QTL 78		0.001	arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	1	169112897	197261052	Rat
634321	Hc1	Hypercalciuria QTL 1	2.91		urine calcium amount (VT:0002985)	urine calcium excretion rate (CMO:0000763)	1	178810256	240830002	Rat
724562	Rends1	Renal damage susceptibility QTL 1		0.05	kidney glomerulus integrity trait (VT:0010546)	index of glomerular damage (CMO:0001135)	1	169537671	214537671	Rat
2292222	Bp307	Blood pressure QTL 307	3.06	0.0014	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	164310393	213533942	Rat
2292220	Bp306	Blood pressure QTL 306	3.47	0.00087	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	164310393	243914901	Rat
1354615	Cm32	Cardiac mass QTL 32	5.2		heart left ventricle mass (VT:0007031)	heart left ventricle wet weight (CMO:0000071)	1	102813953	201278233	Rat
1600380	Niddm70	Non-insulin dependent diabetes mellitus QTL 70	3.1	0.0008	blood insulin amount (VT:0001560)	plasma insulin level (CMO:0000342)	1	176550523	221550523	Rat
1354610	Bw34	Body weight QTL 34	4.1		body mass (VT:0001259)	body weight (CMO:0000012)	1	151162512	256448636	Rat
1354620	Kidm19	Kidney mass QTL 19	4		kidney mass (VT:0002707)	calculated kidney weight (CMO:0000160)	1	151162512	201278233	Rat
1354618	Kidm15	Kidney mass QTL 15	5		kidney mass (VT:0002707)	left kidney wet weight (CMO:0000083)	1	156677124	201278233	Rat
6903303	Scl34	Serum cholesterol QTL 34	2.5	0.0033	blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	1	180359209	218108781	Rat
152025212	Bw190	Body weight QTL 190	5.7		body mass (VT:0001259)		1	123556856	196963478	Rat
631549	Bp89	Blood pressure QTL 89	5.7		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	123350581	201284552	Rat
1358189	Cstrr1	Cold stress response QTL 1		0.0001	catecholamine amount (VT:0010543)	urine norepinephrine level (CMO:0001629)	1	123350408	182418476	Rat
2293083	Iddm25	Insulin dependent diabetes mellitus QTL 25	4.18		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	1	181829673	224569684	Rat
1354606	Bp246	Blood pressure QTL 246	3.6		arterial blood pressure trait (VT:2000000)	pulse pressure (CMO:0000292)	1	102813953	218753816	Rat
738032	Hcas5	Hepatocarcinoma susceptibility QTL 5	3.12		liver integrity trait (VT:0010547)	liver tumorous lesion number (CMO:0001068)	1	176426412	257976495	Rat
1354602	Bw35	Body weight QTL 35	12.2		body mass (VT:0001259)	body weight (CMO:0000012)	1	151162512	201278233	Rat
2325725	Eae31	Experimental allergic encephalomyelitis QTL 31			nervous system integrity trait (VT:0010566)	experimental autoimmune encephalomyelitis severity score (CMO:0001419)	1	178810256	188377506	Rat
631670	Iddm10	Insulin dependent diabetes mellitus QTL 10	1.9		blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	1	174133260	196383668	Rat

Database	Acc Id	Source(s)
NCBI Gene	308998	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailable


InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailable


Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
		Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable

Create Name:

Description:

Send us a Message

Marker: UniSTS:235786