AA850129 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: AA850129

Symbol: AA850129
Previously known as:
RGD ID: 5086351
Expected Size: 185 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.262,003,555 - 2,003,740 (-)MAPPERmRatBN7.2
Rnor_6.01760,886,537 - 60,886,721NCBIRnor6.0
Rnor_6.01760,884,759 - 60,884,947NCBIRnor6.0
Rnor_5.01762,662,651 - 62,662,836NCBIRnor5.0
Rnor_5.01762,661,484 - 62,661,673NCBIRnor5.0
RGSC_v3.41764,591,525 - 64,591,710UniSTSRGSC3.4
RGSC_v3.4616,599,303 - 16,599,487UniSTSRGSC3.4
Celera61,805,077 - 1,805,261UniSTS
RH 3.4 Map17572.2UniSTS
Cytogenetic Map17q12.1UniSTS
Cytogenetic Map18p12UniSTS
Is Marker For: Genes:   RGD1562093   Wac   LOC100360971  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GCTGAGCTTTCCTGTTGTTTCTG
Reverse Primer ACTTCCCAAGTGGTGTCATTTGT
 

Region



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
8552962Pigfal16Plasma insulin-like growth factor 1 level QTL 169.4blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)6141223769Rat
7411603Foco13Food consumption QTL 135.50.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)6141223769Rat
1598843Cm63Cardiac mass QTL 632.6heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)6139036266Rat
738024Sach5Saccharine consumption QTL 53.90.00039consumption behavior trait (VT:0002069)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)6143394190Rat
1549905Stresp10Stress response QTL 106.830.0066stress-related behavior trait (VT:0010451)number of approaches toward negative stimulus before onset of defensive burying response (CMO:0001960)6127574569Rat
7411542Bw127Body weight QTL 1275.50.001body mass (VT:0001259)body weight gain (CMO:0000420)6141223769Rat
9589048Scfw3Subcutaneous fat weight QTL 34.570.001subcutaneous adipose mass (VT:1000472)abdominal subcutaneous fat pad weight (CMO:0002069)6141223769Rat
1331743Uae28Urinary albumin excretion QTL 284.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)6134235784Rat
738023Alc17Alcohol consumption QTL 173.10.003consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)6127574569Rat
1354616Despr12Despair related QTL 120.0012locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)6127574569Rat
2293709Bss23Bone structure and strength QTL 235.180.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)6142487980Rat
2293650Bss31Bone structure and strength QTL 315.050.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)6142487980Rat
7411584Foco4Food consumption QTL 44.30.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)6142838846Rat
2300176Bmd51Bone mineral density QTL 5111.70.0001femur mineral mass (VT:0010011)bone mineral density (CMO:0001226)6127574569Rat
2301972Bp325Blood pressure QTL 3254.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)6172227641Rat
2293656Bss28Bone structure and strength QTL 286.790.0001femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)6142487980Rat
9589129Insul24Insulin level QTL 2419.060.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)6141223769Rat
2300190Bmd52Bone mineral density QTL 5211.20.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)6127574569Rat
1578758Tcas9Tongue tumor susceptibility QTL 93.29tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)6137618905Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100360971 UniSTS
  307029 UniSTS
  498824 UniSTS