AA866326 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: AA866326

Symbol: AA866326
Previously known as:
RGD ID: 5085934
Expected Size: 212 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21346,690,604 - 46,690,816 (+)MAPPERmRatBN7.2
Rnor_6.01352,084,014 - 52,084,225NCBIRnor6.0
Rnor_5.01357,135,624 - 57,135,835UniSTSRnor5.0
RGSC_v3.41348,259,034 - 48,259,245UniSTSRGSC3.4
Celera1347,013,317 - 47,013,528UniSTS
RH 3.4 Map13165.5UniSTS
Cytogenetic Map13q13UniSTS
Is Marker For: Genes:   Elf3  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GCCACCAGCACTCAGTAGAGAA
Reverse Primer GGGAGGAGACTACAGGGACAGA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1310687Elf3E74 like ETS transcription factor 3134669046046695394Rat

Nucleotide Sequences
RefSeq Transcripts NM_001024768 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide BC097980 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1298066Bp159Blood pressure QTL 1590.004arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)134608804691088046Rat
10755495Bp387Blood pressure QTL 3873.78arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133466346187525369Rat
9589141Insul28Insulin level QTL 2810.820.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)13931346554313465Rat
6893344Cm79Cardiac mass QTL 791.50.04heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)134372077062022792Rat
70220Bp55Blood pressure QTL 555.75arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)133737450982374509Rat
71119Thym2Thymus enlargement QTL 23.8thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)134619797684753113Rat
61391Bp5Blood pressure QTL 55.6arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)132230187567301875Rat
4889861Pur29Proteinuria QTL 2913.80.005urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)133741558480753406Rat
2317040Aia21Adjuvant induced arthritis QTL 212.75joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)13983154154831541Rat
631645Bp121Blood pressure QTL 1213.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)131491565559915655Rat
2317046Aia8Adjuvant induced arthritis QTL 83.9700000286102295joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)13983154154831541Rat
12879441Bp396Blood pressure QTL 396arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)134569998390699983Rat
619615Bp80Blood pressure QTL 800.0354arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133975454484754544Rat
1581570Eae17Experimental allergic encephalomyelitis QTL 174.1nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)138897350101631289Rat
70170Eae14Experimental allergic encephalomyelitis QTL 140.0024nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)132320344868203448Rat
1331784Bp222Blood pressure QTL 2222.944arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)131769443653050594Rat
61340Bp25Blood pressure QTL 254.20.004arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133453521879535218Rat
1581573Uae36Urinary albumin excretion QTL 36urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)13599483377046787Rat
1549897Stresp12Stress response QTL 123.35stress-related behavior trait (VT:0010451)number of approaches toward negative stimulus before onset of defensive burying response (CMO:0001960)133843340883433408Rat
7207885Glom27Glomerulus QTL 273.9kidney glomerulus integrity trait (VT:0010546)kidney crescentic glomeruli count to kidney normal glomeruli count ratio (CMO:0002139)1320605871101339738Rat
4145117Mcs27Mammary carcinoma susceptibility QTL 270.0001mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)134343790447841255Rat
1558644Cm45Cardiac mass QTL 453.60.002heart mass (VT:0007028)heart wet weight (CMO:0000069)132369296968692969Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)133124133193395974Rat
61349Bp31Blood pressure QTL 315.75arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)133737450982374509Rat
2303563Bw89Body weight QTL 896body mass (VT:0001259)body weight (CMO:0000012)133228447177284471Rat
1354621Rf47Renal function QTL 473.7kidney renin amount (VT:0010559)kidney renin level (CMO:0002166)1330395351101056920Rat
2301962Cm72Cardiac mass QTL 724.12heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)133124133158363171Rat
1581554Pur11Proteinuria QTL 11urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)13599483377046787Rat
12879477Bp401Blood pressure QTL 401arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)133726209282262092Rat
1331750Bp220Blood pressure QTL 2202.98arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)133741558482415584Rat
6893338Cm76Cardiac mass QTL 7600.99heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)132369296968692969Rat
12879472Bp399Blood pressure QTL 399arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)134522835847841255Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)131101056920Rat
9589164Gluco66Glucose level QTL 666.670.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)131515872260158722Rat
7411662Foco29Food consumption QTL 2920.80.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)13931346554313465Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 304815 UniSTS