AU047491 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: AU047491

Symbol: AU047491
Previously known as:
RGD ID: 5067862
Expected Size: 210 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr81952,526,712 - 52,526,922 (+)Marker Load Pipeline
mRatBN7.21935,617,017 - 35,617,227 (+)MAPPERmRatBN7.2
Rnor_6.01939,785,865 - 39,786,075NCBIRnor6.0
Rnor_5.01950,633,322 - 50,633,532UniSTSRnor5.0
Celera1935,036,027 - 35,036,237UniSTS




#
Reference Title
Reference Citation
1. UniSTS Pipeline RGD automated pipelines


 
Forward Primer GCTGAGGATGACCCCAAACT
Reverse Primer ATTTCCTGTAACCCCAGGTCC
 
GenBank Nucleotide AU047491 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH619492.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 25 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
61447Tcas1Tongue tumor susceptibility QTL 16.08tongue integrity trait (VT:0010553)squamous cell carcinoma of the tongue maximum tumor diameter (CMO:0001875)19231612147316121Rat
9590298Uminl5Urine mineral level QTL 53.590.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)19136824771Rat
724546Kidm3Kidney mass QTL 33.1kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)192932249057337602Rat
1331737Uae29Urinary albumin excretion QTL 295.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)19409615555283277Rat
2298478Eau8Experimental allergic uveoretinitis QTL 80.0163uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)191715443357337602Rat
1578764Stresp19Stress response QTL 193.60.001blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)191563020157337602Rat
9590090Insglur8Insulin/glucose ratio QTL 810.810.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)19136824771Rat
1331788Rf45Renal function QTL 452.818kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)191560502346559041Rat
1549835Tcas7Tongue tumor susceptibility QTL 70.001tongue integrity trait (VT:0010553)squamous cell carcinoma of the head and neck tumor number (CMO:0001876)192481797839654489Rat
724566Uae12Urinary albumin excretion QTL 125urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)19218792756457239Rat

1 to 10 of 25 rows