BI302995 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: BI302995

Symbol: BI302995
Previously known as:
RGD ID: 5064978
Expected Size: 186 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2199,175,476 - 9,175,662 (+)MAPPERmRatBN7.2
Rnor_6.0199,588,810 - 9,588,995NCBIRnor6.0
Rnor_5.0199,573,930 - 9,574,115UniSTSRnor5.0
RGSC_v3.4199,630,826 - 9,631,011UniSTSRGSC3.4
Celera199,074,044 - 9,074,229UniSTS
RH 3.4 Map1972.63UniSTS
Cytogenetic Map19p13UniSTS
Is Marker For: Genes:   Got2  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GCCTGAAGACTGCTTGAACACA
Reverse Primer TTCCAGGCCTATACGGGAACTA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
2722Got2glutamic-oxaloacetic transaminase 21991743049199995Rat

Nucleotide Sequences
GenBank Nucleotide CH474006 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000249 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1549847Bss8Bone structure and strength QTL 84lumbar vertebra strength trait (VT:0010574)vertebra ultimate force (CMO:0001678)19131963836Rat
8552935Pigfal10Plasma insulin-like growth factor 1 level QTL 105.7blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)19136824771Rat
61447Tcas1Tongue tumor susceptibility QTL 16.08tongue integrity trait (VT:0010553)squamous cell carcinoma of the tongue maximum tumor diameter (CMO:0001875)19231612147316121Rat
631681Cm12Cardiac mass QTL 123.330.00053heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)19128982497Rat
9590298Uminl5Urine mineral level QTL 53.590.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)19136824771Rat
10054132Srcrt9Stress Responsive Cort QTL 92.870.0017blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)19127355345Rat
1331737Uae29Urinary albumin excretion QTL 295.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)19409615555283277Rat
724518Uae19Urinary albumin excretion QTL 195.5urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)19745724942983518Rat
8694186Bw152Body weight QTL 1523.340.001body mass (VT:0001259)body weight gain (CMO:0000420)1956937445569374Rat
7411590Foco7Food consumption QTL 76.80.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)19124688055Rat
631678Cm9Cardiac mass QTL 94.270.0001aorta mass (VT:0002845)aorta weight (CMO:0000076)19128982497Rat
9590250Scort11Serum corticosterone level QTL 1123.450.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)19136824771Rat
9590090Insglur8Insulin/glucose ratio QTL 810.810.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)19136824771Rat
2317848Alcrsp21Alcohol response QTL 211.8999999761581420.05response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)19320477748204777Rat
9589102Slep13Serum leptin concentration QTL 134.630.001blood leptin amount (VT:0005667)plasma leptin level (CMO:0000781)1956937445569374Rat
7247442Uae39Urinary albumin excretion QTL 39urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)19218792746708701Rat
724566Uae12Urinary albumin excretion QTL 125urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)19218792756457239Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 25721 UniSTS