BF397960 Marker Search Result - Rat Genome Database

BF397960 Marker Search Result - Rat Genome Database

Submit Data | Help | Video Tutorials | News | Publications | Download | REST API | Citing RGD | Contact

Advanced Search (OLGA)

General

Marker: BF397960

Symbol:

BF397960

Previously known as:

RGD ID:

5062474

Expected Size:

127 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	20	30,887,067 - 30,887,194 (+)	MAPPER	mRatBN7.2
Rnor_6.0	20	32,572,045 - 32,572,171	NCBI	Rnor6.0
Rnor_5.0	20	34,355,951 - 34,356,077	UniSTS	Rnor5.0
RGSC_v3.4	20	30,199,645 - 30,199,771	UniSTS	RGSC3.4
Celera	20	32,302,807 - 32,302,933	UniSTS
RH 3.4 Map	20	307.93	UniSTS

#	Reference Title	Reference Citation
1.	UniSTS Pipeline	RGD automated pipelines


Forward Primer	TGTCACAGGGACAGTGATGATG
Reverse Primer	AGATTTGAATGCAAAGGCCACT

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
1561324	Kpna5	karyopherin subunit alpha 5	20	30822925	30888080	Rat


GenBank Nucleotide	CH474016	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CM000250	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
4889610	Pancm3	Pancreatic morphology QTL 3	3.75	0.001	pancreas mass (VT:0010144)	pancreas wet weight (CMO:0000626)	20	17617832	47606836	Rat
2303587	Bw93	Body weight QTL 93	13		body mass (VT:0001259)	body weight (CMO:0000012)	20	25106722	54435887	Rat
1641915	Colcr9	Colorectal carcinoma resistance QTL 9	2.97	0.0024	intestine integrity trait (VT:0010554)	benign colorectal tumor number (CMO:0001795)	20	1530655	46530655	Rat
7411668	Foco32	Food consumption QTL 32	8	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	20	1	36600972	Rat
2305926	Iddm37	Insulin dependent diabetes mellitus QTL 37	6		blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	20	1527842	46527842	Rat
2303626	Vencon10	Ventilatory control QTL 10		0.001	respiration trait (VT:0001943)	respiration rate (CMO:0000289)	20	19190721	54435887	Rat
1598869	Memor6	Memory QTL 6	3.1		exploratory behavior trait (VT:0010471)	total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)	20	29244388	54435887	Rat
7411652	Foco24	Food consumption QTL 24		0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	20	11757515	54435887	Rat
1331747	Hrtrt16	Heart rate QTL 16	3.163		heart pumping trait (VT:2000009)	heart rate (CMO:0000002)	20	25209734	54435887	Rat
1598816	Memor12	Memory QTL 12	2.4		exploratory behavior trait (VT:0010471)	average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)	20	2606836	47606836	Rat
2303578	Gluco50	Glucose level QTL 50	2		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	20	25106722	54435887	Rat
2317880	Alcrsp25	Alcohol response QTL 25	2.3		response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	20	17697550	54435887	Rat
6893685	Bw111	Body weight QTL 111	2.7	0.004	body mass (VT:0001259)	body weight (CMO:0000012)	20	1	32578807	Rat
9590252	Scort12	Serum corticosterone level QTL 12	20.46	0.001	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	20	1	36600972	Rat
9590092	Insglur9	Insulin/glucose ratio QTL 9	18.38	0.001	blood insulin amount (VT:0001560)	calculated plasma insulin level (CMO:0002170)	20	11757515	54435887	Rat
2300188	Bmd68	Bone mineral density QTL 68	6.4	0.0001	femur mineral mass (VT:0010011)	volumetric bone mineral density (CMO:0001553)	20	25106722	54435887	Rat