RH132985 Marker Search Result - Rat Genome Database

Advanced Search (OLGA)

General

Marker: RH132985

Symbol:

RH132985

Previously known as:

AI547755;

RGD ID:

5048580

Expected Size:

203 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	14	12,194,268 - 12,194,471 (+)	MAPPER	mRatBN7.2
Rnor_6.0	14	13,838,254 - 13,838,456	NCBI	Rnor6.0
Rnor_5.0	14	13,782,196 - 13,782,398	UniSTS	Rnor5.0
RGSC_v3.4	14	13,643,673 - 13,643,875	UniSTS	RGSC3.4
Celera	14	12,256,599 - 12,256,801	UniSTS

Annotation

References - curated

#	Reference Title	Reference Citation
1.	UniSTS Pipeline	RGD automated pipelines

Strains and Sequence

Sequence


Forward Primer	CACATGTGCTCACCCAACATAA
Reverse Primer	GCCTTACTAAAGAGTGAGGCGG

Region

Nucleotide Sequences


GenBank Nucleotide	DH659135	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1300114	Srn2	Serum renin concentration QTL 2	3.27		blood renin amount (VT:0003349)	plasma renin activity level (CMO:0000116)	14	3813074	21217635	Rat
2293089	Iddm31	Insulin dependent diabetes mellitus QTL 31	4.7		blood glucose amount (VT:0000188)	age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)	14	3813074	18274691	Rat
1581500	Renag1	Renal agenesis QTL 1			kidney development trait (VT:0000527)	percentage of study population developing unilateral renal agenesis during a period of time (CMO:0000940)	14	8170668	68298175	Rat
731183	Pia20	Pristane induced arthritis QTL 20	3.55		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	14	9088978	39057237	Rat
631212	Bw5	Body weight QTL5	5.43		retroperitoneal fat pad mass (VT:0010430)	retroperitoneal fat pad weight to body weight ratio (CMO:0000635)	14	11030812	30320092	Rat
2302277	Gluco38	Glucose level QTL 38	5.8		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	14	11030622	28035204	Rat
1331740	Bw26	Body weight QTL 26	3.028		body mass (VT:0001259)	body weight (CMO:0000012)	14	3813074	30767156	Rat
619619	Rf4	Renal disease susceptibility QTL 4	4.1	0.002	urine total protein amount (VT:0000032)	urine protein excretion rate to body weight ratio (CMO:0001099)	14	1	32754612	Rat
1358296	Ael3	Aortic elastin QTL 3	3.7	0.00051	aorta elastin amount (VT:0003905)	aortic elastin	14	8267090	53267090	Rat
70195	Mcs8	Mammary carcinoma susceptibility QTL 8	4.28		mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	14	3813074	24531477	Rat
2300183	Bmd60	Bone mineral density QTL 60	5.7	0.0001	femur mineral mass (VT:0010011)	volumetric bone mineral density (CMO:0001553)	14	1	26541967	Rat
631839	Niddm37	Non-insulin dependent diabetes mellitus QTL 37	3.37		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	14	11030622	95876975	Rat
634352	Apr6	Acute phase response QTL 6	3.7		blood interleukin-6 amount (VT:0008595)	plasma interleukin-6 level (CMO:0001927)	14	1	41131407	Rat
2300159	Bmd61	Bone mineral density QTL 61	5.3	0.0001	femur mineral mass (VT:0010011)	volumetric bone mineral density (CMO:0001553)	14	1	26541967	Rat
70204	Niddm20	Non-insulin dependent diabetes mellitus QTL 20	5.1	0.000008	blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	14	1217606	16960180	Rat
2302045	Pia39	Pristane induced arthritis QTL 39	4.9	0.001	blood immunoglobulin amount (VT:0002460)	serum immunoglobulin G2a level (CMO:0002116)	14	8267090	53267090	Rat

Additional Information

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: RH132985