RH129759 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH129759

Symbol: RH129759
Previously known as: AA996576; 
RGD ID: 5042980
Expected Size: 162 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr871,695,296 - 1,695,458 (+)Marker Load Pipeline
mRatBN7.271,110,779 - 1,110,942 (+)MAPPERmRatBN7.2
Rnor_6.073,105,859 - 3,106,020NCBIRnor6.0
Rnor_5.073,078,559 - 3,078,720UniSTSRnor5.0
RGSC_v3.471,981,102 - 1,981,263UniSTSRGSC3.4
Celera7980,989 - 981,150UniSTS
Cytogenetic Map7q11UniSTS
Is Marker For: Genes:   Rab5b  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AAGGATAGGTAAATCAATCACCC
Reverse Primer CGTCCTCTGAAGCCTGTGTAT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1306489Rab5bRAB5B, member RAS oncogene family711094491128348Rat



QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
61410Bw19Body weight QTL 196.20.001body mass (VT:0001259)body weight (CMO:0000012)7144782185Rat
1300176Hrtrt10Heart rate QTL 103.19heart pumping trait (VT:2000009)heart rate (CMO:0000002)766427026029351Rat
2317047Wbc4White blood cell count QTL 40.01leukocyte quantity (VT:0000217)white blood cell count (CMO:0000027)7135342956Rat
2298550Neuinf6Neuroinflammation QTL 63.3nervous system integrity trait (VT:0010566)spinal cord RT1-B protein level (CMO:0002132)7127829089Rat
631503Bp102Blood pressure QTL 1021.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)7144822433Rat
634336Anxrr17Anxiety related response QTL 173.66locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)7924703115097879Rat
724560Plsm3Polydactyly-luxate syndrome (PLS) morphotypes QTL 30.0003tibia length (VT:0004357)tibia length (CMO:0000450)7134000259Rat
9590142Scort5Serum corticosterone level QTL 524.40.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)7131962314Rat
7411566Bw136Body weight QTL 13610.40.001body mass (VT:0001259)body weight gain (CMO:0000420)7131962314Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 288779 UniSTS