BQ210448 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: BQ210448

Symbol: BQ210448
Previously known as:
RGD ID: 5035200
Expected Size: 215 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2558,029,565 - 58,029,780 (+)MAPPERmRatBN7.2
Rnor_6.0559,275,294 - 59,275,508NCBIRnor6.0
Rnor_5.0563,798,806 - 63,799,020UniSTSRnor5.0
RGSC_v3.4560,263,850 - 60,264,064UniSTSRGSC3.4
Celera556,610,054 - 56,610,268UniSTS
RH 3.4 Map5376.7UniSTS


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AAGAGTGTACCAGGGCTGAGGA
Reverse Primer ATCTCATGTTGGCCATTAACCC
 

Region

Nucleotide Sequences
GenBank Nucleotide CH473962 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000235 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1578776Stresp18Stress response QTL 182.9thymus mass (VT:0004954)thymus wet weight (CMO:0000855)52795544072955440Rat
1298067Scl15Serum cholesterol level QTL 154.80.001blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)53321566578215665Rat
1300115Hrtrt7Heart rate QTL 72.76heart pumping trait (VT:2000009)heart rate (CMO:0000002)54786906290099692Rat
1549845Scl44Serum cholesterol level QTL 446blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)540128307148607290Rat
70212Niddm25Non-insulin dependent diabetes mellitus QTL 253.54blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)51131345958Rat
1358353Srcrtb2Stress Responsive Cort Basal QTL 23.480.003blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)51887394774251464Rat
634305Mamtr1Mammary tumor resistance QTL 10.0001mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)512789751113558310Rat
1331801Rf33Renal function QTL 334.149kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)543726656129132602Rat
1598807Glom12Glomerulus QTL 122.7kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)53321566578215665Rat
1302786Kidm8Kidney mass QTL 828.15kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)53321566578215665Rat
6903292Stl28Serum triglyceride level QTL 282.60.0073blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)52851548973515489Rat
1578766Tcas11Tongue tumor susceptibility QTL 114.12tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)546711509161317411Rat
1578767Stresp17Stress response QTL 174.30.01blood aldosterone amount (VT:0005346)plasma aldosterone level (CMO:0000551)52795544072955440Rat
7411561Bw134Body weight QTL 134240.001body mass (VT:0001259)body weight gain (CMO:0000420)54946360094463600Rat
1641922Alcrsp8Alcohol response QTL 8alcohol metabolism trait (VT:0015089)blood ethanol level (CMO:0000535)53518915368564008Rat
2303615Vencon7Ventilatory control QTL 70.001respiration trait (VT:0001943)respiration rate (CMO:0000289)55098389595983895Rat
1576312Emca8Estrogen-induced mammary cancer QTL 84.1mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)550328551141643988Rat
1641912Alcrsp18Alcohol response QTL 18response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)535189153141643988Rat
1576314Eutr1Estrogen induced uterine response QTL 1uterus integrity trait (VT:0010575)pyometritis severity score (CMO:0002009)52138965166875058Rat
6903306Scl35Serum cholesterol QTL 352.60.0073blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)52851548973515489Rat
1576317Eutr2Estrogen induced uterine response QTL 20.01uterus integrity trait (VT:0010575)pyometritis severity score (CMO:0002009)534730116104251008Rat
7394712Emca13Estrogen-induced mammary cancer QTL 13mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)5982326699753708Rat
1331773Scl26Serum cholesterol level QTL 263.065blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)54372665686724018Rat
70189Mcs5Mammary carcinoma susceptibility QTL 510.51mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)555805606132207589Rat
1331771Rf35Renal function QTL 354.36965kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)572947086724018Rat
61359EaexExperimental allergic encephalomyelitis QTL x3nervous system integrity trait (VT:0010566)post-insult time to onset of experimental autoimmune encephalomyelitis (CMO:0001422)555715622100715622Rat
8662454Vetf3Vascular elastic tissue fragility QTL 327.4artery integrity trait (VT:0010639)number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562)5228222669540447Rat
2290448Scl54Serum cholesterol level QTL 542.93blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)531663789131345958Rat
9589025Epfw7Epididymal fat weight QTL 720.660.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)54946360094463600Rat
2303574Gluco42Glucose level QTL 422blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)55349671998496719Rat
1331756Rf34Renal function QTL 344.16275kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)5190450412Rat
8552954Pigfal14Plasma insulin-like growth factor 1 level QTL 149blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)52122674466226744Rat
2316959Gluco59Glucose level QTL 594.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)534944474113558310Rat
1600358Mamtr5Mammary tumor resistance QTL 5mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)51887394763873947Rat


Additional Information