RH144332 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: RH144332

Symbol: RH144332
Previously known as: AW526592; 
RGD ID: 5029315
Expected Size: 169 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21945,262,363 - 45,262,532 (+)MAPPERmRatBN7.2
Rnor_6.01949,750,222 - 49,750,390NCBIRnor6.0
Rnor_5.01960,537,201 - 60,537,369UniSTSRnor5.0
RGSC_v3.41947,318,940 - 47,319,108UniSTSRGSC3.4
Celera1944,534,264 - 44,534,432UniSTS
RH 3.4 Map19606.0UniSTS


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGGTCCAGATTGTCCATCAA
Reverse Primer ACAAGGCAGGAGGAGACAGA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1307766Gangigaxonin194520778345265066Rat

Nucleotide Sequences
GenBank Nucleotide DH604636 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DH754567 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
61350Bp32Blood pressure QTL 320.012arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)192048357557337602Rat
61447Tcas1Tongue tumor susceptibility QTL 16.08tongue integrity trait (VT:0010553)squamous cell carcinoma of the tongue maximum tumor diameter (CMO:0001875)19231612147316121Rat
724546Kidm3Kidney mass QTL 33.1kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)192932249057337602Rat
7411549Bw130Body weight QTL 13050.001body mass (VT:0001259)body weight gain (CMO:0000420)191545586057337602Rat
1358200Insglur2Insulin/glucose ratio QTL 24.1blood glucose amount (VT:0000188)serum glucose level (CMO:0000543)193383821455283146Rat
1331737Uae29Urinary albumin excretion QTL 295.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)19409615555283277Rat
2298478Eau8Experimental allergic uveoretinitis QTL 80.0163uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)191715443357337602Rat
8694186Bw152Body weight QTL 1523.340.001body mass (VT:0001259)body weight gain (CMO:0000420)1956937445569374Rat
1578764Stresp19Stress response QTL 193.60.001blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)191563020157337602Rat
5135224Leukc1Leukocyte quantity QTL 1eosinophil quantity (VT:0002602)blood eosinophil count (CMO:0000033)194434021455283277Rat
1331788Rf45Renal function QTL 452.818kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)191560502346559041Rat
2317848Alcrsp21Alcohol response QTL 211.8999999761581420.05response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)19320477748204777Rat
9589102Slep13Serum leptin concentration QTL 134.630.001blood leptin amount (VT:0005667)plasma leptin level (CMO:0000781)1956937445569374Rat
7247442Uae39Urinary albumin excretion QTL 39urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)19218792746708701Rat
724566Uae12Urinary albumin excretion QTL 125urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)19218792756457239Rat


Additional Information