RH132704 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH132704

Symbol: RH132704
Previously known as: AI556940; 
RGD ID: 5026566
Expected Size: 842 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr8174,465,865 - 74,466,707 (+)Marker Load Pipeline
mRatBN7.2165,550,505 - 65,551,347 (+)MAPPERmRatBN7.2
Rnor_6.0164,125,405 - 64,126,246NCBIRnor6.0
Rnor_5.0163,117,687 - 63,118,528UniSTSRnor5.0
RGSC_v3.4163,863,434 - 63,864,275UniSTSRGSC3.4
Celera163,275,548 - 63,276,389UniSTS
RH 3.4 Map1741.5UniSTS
Cytogenetic Map1q12UniSTS
Is Marker For: Genes:   Tmc4   Leng1   LOC100909619  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CTTCCGTCTCTATCTGGCGTTT
Reverse Primer GATCCCTGAGTCCATTGAGAGC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1304811Tmc4transmembrane channel-like 417445513574467043Rat



QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1331732Srn4Serum renin concentration QTL 44.467renin activity (VT:0005581)plasma renin activity level (CMO:0000116)14345783787558729Rat
1578649Bmd8Bone mineral density QTL 84.9femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)151940904101229020Rat
1358359Sradr1Stress Responsive Adrenal Weight QTL 14.74adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)139728272132889942Rat
4889929Bss87Bone structure and strength QTL 876.7tibia area (VT:1000281)tibia-fibula cortical bone endosteal cross-sectional area (CMO:0001722)14630261591302615Rat
634314Niddm44Non-insulin dependent diabetes mellitus QTL 44blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)151941022208479811Rat
1331792Rf29Renal function QTL 294.589urine potassium amount (VT:0010539)urine potassium level (CMO:0000128)14345783787558729Rat
2313062Bmd73Bone mineral density QTL 733.90.0001tibia mineral mass (VT:1000283)compact volumetric bone mineral density (CMO:0001730)14630261591302615Rat
8552900Pigfal1Plasma insulin-like growth factor 1 level QTL 17.4blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)14350995288509952Rat
1578654Bss10Bone structure and strength QTL 104femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)151940904168768703Rat
1354643Foco2Food consumption QTL 27.170.0001eating behavior trait (VT:0001431)food intake rate (CMO:0000427)14212296887122968Rat
2313065Bss67Bone structure and strength QTL 673.10.0001tibia area (VT:1000281)tibia total energy absorbed before break (CMO:0001736)14630261591302615Rat
2313069Bss68Bone structure and strength QTL 682.90.0001tibia size trait (VT:0100001)tibia total energy absorbed before break (CMO:0001736)14630261591302615Rat
631495Bp96Blood pressure QTL 964.52arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)166404680111404680Rat
70225Bp58Blood pressure QTL 583.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)134184556172281316Rat
2313075Bss66Bone structure and strength QTL 663.40.0001tibia length (VT:0004357)tibia length (CMO:0000450)14630261591302615Rat
2298545Neuinf8Neuroinflammation QTL 84.6nervous system integrity trait (VT:0010566)spinal cord beta-2 microglobulin mRNA level (CMO:0002125)166009857160501508Rat
10059597Bp377Blood pressure QTL 3773.420.025arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)134565911208798288Rat
1331778Rf28Renal function QTL 284.66urine potassium amount (VT:0010539)urine potassium excretion rate (CMO:0000761)14345783787558729Rat
2313077Bss69Bone structure and strength QTL 693.50.0001tibia strength trait (VT:1000284)bone polar moment of inertia (CMO:0001558)14630261591302615Rat
1302788Scl19Serum cholesterol QTL 194.60.001blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)166400974132889942Rat
2313402Anxrr24Anxiety related response QTL 24aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)151511344153680016Rat
1331785Rf27Renal function QTL 274.643urine sodium amount (VT:0006274)urine sodium level (CMO:0000129)13070837587558729Rat
61342Bp27Blood pressure QTL 273.40.0006arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16540563796805205Rat
1300172Bp172Blood pressure QTL 1723.56arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)13456572679565726Rat
4889962Bss94Bone structure and strength QTL 943.8tibia area (VT:1000281)tibia-fibula cortical bone endosteal cross-sectional area (CMO:0001722)15190920691302615Rat
6903308Scl36Serum cholesterol QTL 3620.0125blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)158769992103769992Rat
2313092Bmd72Bone mineral density QTL 722.50.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)14630261591302615Rat
2300164Bmd44Bone mineral density QTL 445.40.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)166077886111077886Rat
2313097Bss70Bone structure and strength QTL 703.50.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)14630261591302615Rat
9589820Insglur3Insulin/glucose ratio QTL 310.750.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)14350995288509952Rat
1354599Bw29Body weight QTL 293.460.001body mass (VT:0001259)body weight (CMO:0000012)14212296887122968Rat
4889919Bss86Bone structure and strength QTL 864.1tibia area (VT:1000281)tibia midshaft total cross-sectional area (CMO:0001715)14630261591302615Rat
8552948Pigfal11Plasma insulin-like growth factor 1 level QTL 114.7blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)14350995288509952Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100909619 UniSTS
  292535 UniSTS
  308310 UniSTS