D13Got1 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D13Got1

Symbol: D13Got1
Previously known as: OT04.44; oxsts928; 
RGD ID: 45035
Expected Size: 219 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21336,139,191 - 36,139,409 (+)MAPPERmRatBN7.2
Rnor_6.01341,043,527 - 41,043,742NCBIRnor6.0
Rnor_5.01346,154,609 - 46,154,824UniSTSRnor5.0
RGSC_v3.41337,174,673 - 37,174,889RGDRGSC3.4
RGSC_v3.41337,174,674 - 37,174,889UniSTSRGSC3.4
RGSC_v3.11337,188,638 - 37,188,854RGD
Celera1335,953,479 - 35,953,694UniSTS
RH 2.0 Map13272.8RGD
Cytogenetic Map13q11UniSTS
Is Marker For: Genes:   Dpp10  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. UniSTS Pipeline RGD automated pipelines
3. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
4. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer GATCTCCAGGGACACTTGTCA
Reverse Primer TCCATGTCTCTAGAATGCAAAAG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1306427Dpp10dipeptidyl peptidase like 10133458442036269619Rat
11432035LOC108352624uncharacterized LOC108352624133594992936144808Rat

Nucleotide Sequences
GenBank Nucleotide AU029023 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
738036Lnnr4Liver neoplastic nodule remodeling QTL 43.64liver integrity trait (VT:0010547)liver remodeling tumorous lesion number (CMO:0001461)13142356786Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)131101056920Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)131101056920Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)131101056920Rat
61339Bp24Blood pressure QTL 240.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)13599466844807491Rat
1581554Pur11Proteinuria QTL 11urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)13599483377046787Rat
1581573Uae36Urinary albumin excretion QTL 36urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)13599483377046787Rat
1581570Eae17Experimental allergic encephalomyelitis QTL 174.1nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)138897350101631289Rat
7411662Foco29Food consumption QTL 2920.80.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)13931346554313465Rat
9589141Insul28Insulin level QTL 2810.820.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)13931346554313465Rat
2317040Aia21Adjuvant induced arthritis QTL 212.75joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)13983154154831541Rat
2317046Aia8Adjuvant induced arthritis QTL 83.9700000286102295joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)13983154154831541Rat
1300163Cardf1Cardiac cell morphology QTL 14.18aorta morphology trait (VT:0000272)artery lesion measurement (CMO:0000975)131192944945417941Rat
2302275Gluco37Glucose level QTL 373.8blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)131192944946193066Rat
631645Bp121Blood pressure QTL 1213.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)131491565559915655Rat
9589164Gluco66Glucose level QTL 666.670.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)131515872260158722Rat
1331784Bp222Blood pressure QTL 2222.944arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)131769443653050594Rat
7207885Glom27Glomerulus QTL 273.9kidney glomerulus integrity trait (VT:0010546)kidney crescentic glomeruli count to kidney normal glomeruli count ratio (CMO:0002139)1320605871101339738Rat
61391Bp5Blood pressure QTL 55.6arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)132230187567301875Rat
70170Eae14Experimental allergic encephalomyelitis QTL 140.0024nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)132320344868203448Rat
6893338Cm76Cardiac mass QTL 7600.99heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)132369296968692969Rat
1558644Cm45Cardiac mass QTL 453.60.002heart mass (VT:0007028)heart wet weight (CMO:0000069)132369296968692969Rat
2303030Bp327Blood pressure QTL 327arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)133039535141184251Rat
1354621Rf47Renal function QTL 473.7kidney renin amount (VT:0010559)kidney renin level (CMO:0002166)1330395351101056920Rat
2301962Cm72Cardiac mass QTL 724.12heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)133124133158363171Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)133124133193395974Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133124133193395974Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)133124133193395974Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)133124133193395974Rat
2303563Bw89Body weight QTL 896body mass (VT:0001259)body weight (CMO:0000012)133228447177284471Rat
61453Pur1Proteinuria QTL 118.06urine total protein amount (VT:0000032)urine protein level (CMO:0000591)133453521837415726Rat
61340Bp25Blood pressure QTL 254.20.004arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133453521879535218Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 363972 UniSTS
UniSTS 111767 UniSTS