D8Got85 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D8Got85

Symbol: D8Got85
Previously known as: oxsts2654; OT53.32; 
RGD ID: 44426
Expected Size: 262 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2854,949,901 - 54,950,163 (+)MAPPERmRatBN7.2
Rnor_6.0859,142,713 - 59,142,974NCBIRnor6.0
Rnor_5.0857,723,391 - 57,723,652UniSTSRnor5.0
RGSC_v3.4858,113,576 - 58,113,836RGDRGSC3.4
RGSC_v3.4858,113,575 - 58,113,836UniSTSRGSC3.4
RGSC_v3.1858,132,630 - 58,132,890RGD
Celera854,438,549 - 54,438,804UniSTS
RH 3.4 Map8603.9UniSTS
RH 3.4 Map8603.9RGD
RH 2.0 Map8463.4RGD




#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8


 
Forward Primer GGCAGGCACAAGTAAAGGTT
Reverse Primer TCGATCAAACATACTACCCTGC
 
GenBank Nucleotide AU026447 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 62 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
1298065Scl16Serum cholesterol level QTL 163.8blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)83085640475856404Rat
1554321Bmd3Bone mineral density QTL 37.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)840952565123900184Rat
1578769Uae31Urinary albumin excretion QTL 313.30.001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)830848154101699754Rat
1298079Activ2Activity QTL 29.50.000001voluntary movement trait (VT:0003491)rearing measurement (CMO:0001515)84186687686866876Rat
11556286Cm81Cardiac mass QTL 810.01heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)83084815461290444Rat
70161Bp62Blood pressure QTL 622.90.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)84269268490165460Rat
1578765Klgr1Kidney lesion grade QTL 13.30.0001kidney morphology trait (VT:0002135)organ lesion measurement (CMO:0000677)830848154101699754Rat
1582222Epfw2Epididymal fat weight QTL 23.20.0005epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)83173772976737729Rat
61464Niddm11Non-insulin dependent diabetes mellitus QTL 113.10.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)83558203280582032Rat
4889938Bss89Bone structure and strength QTL 893.8tibia size trait (VT:0100001)tibia cortical bone volume (CMO:0001725)85009524982460899Rat

1 to 10 of 62 rows