D3Wox27 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D3Wox27

Symbol: D3Wox27
Previously known as: oxsts4909; R53; ivd; 
RGD ID: 43675
Expected Size: 133 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.23105,871,874 - 105,872,003 (+)MAPPERmRatBN7.2
Rnor_6.03110,689,520 - 110,689,648NCBIRnor6.0
Rnor_5.03117,227,457 - 117,227,585UniSTSRnor5.0
RGSC_v3.43105,394,591 - 105,394,720RGDRGSC3.4
RGSC_v3.43105,394,592 - 105,394,720UniSTSRGSC3.4
RGSC_v3.13105,291,019 - 105,291,148RGD
Celera3104,785,710 - 104,785,838UniSTS
RH 3.4 Map3913.79UniSTS
RH 3.4 Map3913.79RGD
RH 2.0 Map3590.1RGD
Cytogenetic Map3q35UniSTS
Is Marker For: Genes:   Ivd  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer GAAAGCCTAAAATTCGGTCC
Reverse Primer AGGGCGCAGACACTGTTAC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
2936Ivdisovaleryl-CoA dehydrogenase3105851710105872144Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2312673Scl63Serum cholesterol level QTL 630.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)398535255168026850Rat
2301414Kidm37Kidney mass QTL 370.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)370653097121056321Rat
2302373Gluco39Glucose level QTL 395.01blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)398535386161695835Rat
1582238Bw68Body weight QTL 683.20.0064body mass (VT:0001259)body weight (CMO:0000012)353184593115665732Rat
1582239Epfw1Epididymal fat weight QTL 14.50.0006epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)353184593115665732Rat
70216Cm14Cardiac mass QTL 142.1heart mass (VT:0007028)heart wet weight (CMO:0000069)331172320163586636Rat
2292591Esta4Estrogen-induced thymic atrophy QTL 4thymus mass (VT:0004954)thymus wet weight (CMO:0000855)347233211147415807Rat
1358362Srcrt2Stress Responsive Cort QTL 22.78blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)338192233133483320Rat
1582216Bw65Body weight QTL 656.3body mass (VT:0001259)body weight (CMO:0000012)3102200529115665732Rat
737818Hcar12Hepatocarcinoma resistance QTL 122.6liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)329463235118376539Rat
1582218Bw74Body weight QTL 743.90.0021body mass (VT:0001259)body weight (CMO:0000012)353184593115665732Rat
1582219Bw63Body weight QTL 633.80.001body mass (VT:0001259)body weight (CMO:0000012)396127817115665732Rat
1582221Kidm30Kidney mass QTL 303.50.0008kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)364655305115665732Rat
1581568Rf53Renal function QTL 53urine total protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)356395968161299569Rat
1582210Bw71Body weight QTL 713.30.0012body mass (VT:0001259)body weight (CMO:0000012)364655305115665732Rat
7387306Bw124Body weight QTL 1243.20.0003body mass (VT:0001259)body weight (CMO:0000012)384091273129091273Rat
1300111Rf12Renal function QTL 123.78renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)361017749121056321Rat
724523Tsu1Thymus enlargement suppressive QTL 13.84thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)350437504115638231Rat
1600376Arunc5Aerobic running capacity QTL 50.21exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)373376539118376539Rat
8694437Bw167Body weight QTL 16722.460.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)391797474136797474Rat
2302273Gluco35Glucose level QTL 355.30.001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)380800231114297550Rat
8662816Vetf4Vascular elastic tissue fragility QTL 44renal artery integrity trait (VT:0010642)number of ruptures of the internal elastic lamina of the renal arteries (CMO:0002563)359242096157323038Rat
1559282Emca5Estrogen-induced mammary cancer QTL 53.9mammary gland integrity trait (VT:0010552)percentage of study population developing mammary tumors during a period of time (CMO:0000948)343827364169034231Rat
1581503Cm58Cardiac mass QTL 582.70.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)343827364121056321Rat
1354611Despr2Despair related QTL 23.030.0028locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)397084464142084464Rat
2292613Ept16Estrogen-induced pituitary tumorigenesis QTL 168.3pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)347233430110362260Rat
631649Bp123Blood pressure QTL 1233.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)389772419134772419Rat
631841Niddm39Non-insulin dependent diabetes mellitus QTL 393.36blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)394856903159898684Rat
12879848Bw181Body weght QTL 1810.015body mass (VT:0001259)body weight (CMO:0000012)370348525121056321Rat
2312659Slep7Serum leptin concentration QTL 70.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)398535255168026850Rat
2301971Cm71Cardiac mass QTL 714.63heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)341874578155617519Rat
2301970Bw81Body weight QTL 815.19body mass (VT:0001259)body weight (CMO:0000012)341874578155617519Rat
1358885Bp251Blood pressure QTL 2513.8arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)314489145121056321Rat
1581546Pur13Proteinuria QTL 132.930.0335urine total protein amount (VT:0000032)urine protein excretion rate (CMO:0000759)378196190146592722Rat
631665Bw8Body weight QTL 85.5body mass (VT:0001259)body weight (CMO:0000012)350437042119183768Rat
1358888Bp264Blood pressure QTL 2644.43arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)314489145121056321Rat
2312670Bw94Body weight QTL 940.01inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)398535255168026850Rat
2293087Iddm27Insulin dependent diabetes mellitus QTL 272.68blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)397551417147415807Rat
1358186Ept2Estrogen-induced pituitary tumorigenesis QTL 28.3pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)347233430110362260Rat
724532Cm17Cardiac mass QTL 172heart mass (VT:0007028)calculated heart weight (CMO:0000073)395735366140735366Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 24513 UniSTS