RH122893 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: RH122893

Symbol: RH122893
Previously known as: SHGC-103786; 
RGD ID: 1718247
Expected Size: 323 (bp)
Position
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh375140,344,075 - 140,344,397UniSTSGRCh37
Build 365140,324,259 - 140,324,581RGDNCBI36
Celera5136,420,859 - 136,421,181RGD
Cytogenetic Map5q31UniSTS
HuRef5135,488,790 - 135,489,112UniSTS
TNG Radiation Hybrid Map565054.0UniSTS
Is Marker For: Genes:   PCDHA4   PCDHA3   PCDHA2   PCDHAC2   PCDHA8   PCDHA13   PCDHA12   PCDHA6   PCDHA9   PCDHA10   PCDHA1   PCDHAC1   PCDHA5   PCDHA11   PCDHA@   PCDHA7  




#
Reference Title
Reference Citation
1. UniSTS Pipeline RGD automated pipelines


 
Forward Primer ATTCCTGTCTCCTTTCTTGGGTC
Reverse Primer TCTATGCCTGGTCAATACCCAGT
 


1 to 17 of 17 rows
GenBank Nucleotide AC004776 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC010223 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH003452 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH003500 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH471062 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000256 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000466 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000495 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000667 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM001613.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS486067 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS990705 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  G57987 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL000050 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL301909.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL582980 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH976330.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
1 to 17 of 17 rows



1 to 16 of 16 rows
Database
Acc Id
Source(s)
NCBI Gene 56117 UniSTS
  56134 UniSTS
  56135 UniSTS
  56136 UniSTS
  56137 UniSTS
  56138 UniSTS
  56139 UniSTS
  56140 UniSTS
  56141 UniSTS
  56142 UniSTS
  56143 UniSTS
  56144 UniSTS
  56145 UniSTS
  56146 UniSTS
  56147 UniSTS
  9752 UniSTS
1 to 16 of 16 rows