D1Ztm8 Marker Search Result - Rat Genome Database

Advanced Search (OLGA)

General

Marker: D1Ztm8

Symbol:

D1Ztm8

Previously known as:

RGD ID:

1576374

Expected Size:

222 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	1	15,202,832 - 15,203,054 (+)	MAPPER	mRatBN7.2
Rnor_6.0	1	15,913,643 - 15,913,864	NCBI	Rnor6.0
Rnor_5.0	1	17,458,256 - 17,458,477	UniSTS	Rnor5.0
RGSC_v3.4	1	15,722,312 - 15,722,533	UniSTS	RGSC3.4
Celera	1	13,633,354 - 13,633,575	UniSTS
Cytogenetic Map	1	p12	UniSTS

Is Marker For:

Genes: Pde7b

#	Reference Title	Reference Citation
1.	UniSTS Pipeline	RGD automated pipelines
2.	Genetic analysis of the LEW.1AR1-iddm rat: an animal model for spontaneous diabetes mellitus.	Weiss H, etal., Mamm Genome 2005 Jun;16(6):432-41.


Forward Primer	GGCAACACATCCAGACTTCA
Reverse Primer	ACTCCAGCTCCAGGAGATCTAA

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
621016	Pde7b	phosphodiesterase 7B	1	15174001	15493267	Rat


GenBank Nucleotide	CH473994	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CM000231	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
631688	Hcas2	Hepatocarcinoma susceptibility QTL 2	3	0.0001	liver integrity trait (VT:0010547)	liver tumorous lesion number (CMO:0001068)	1	5925874	115540829	Rat
1578650	Bmd6	Bone mineral density QTL 6	12.2		femur mineral mass (VT:0010011)	total volumetric bone mineral density (CMO:0001728)	1	509108	43284926	Rat
1354647	Despr8	Despair related QTL 8		0.0000341	locomotor behavior trait (VT:0001392)	amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)	1	1	24744506	Rat
1578651	Bmd7	Bone mineral density QTL 7	14.2		femur mineral mass (VT:0010011)	compact volumetric bone mineral density (CMO:0001730)	1	509108	43284926	Rat
2313062	Bmd73	Bone mineral density QTL 73	3.9	0.0001	tibia mineral mass (VT:1000283)	compact volumetric bone mineral density (CMO:0001730)	1	11481312	82174945	Rat
1554320	Bmd1	Bone mineral density QTL 1	12.2	0.0001	femur mineral mass (VT:0010011)	volumetric bone mineral density (CMO:0001553)	1	509108	86060548	Rat
2313065	Bss67	Bone structure and strength QTL 67	3.1	0.0001	tibia area (VT:1000281)	tibia total energy absorbed before break (CMO:0001736)	1	11481312	82174945	Rat
7421626	Bp360	Blood pressure QTL 360		0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	4393289	49393289	Rat
2313070	Bss52	Bone structure and strength QTL 52	4.4	0.0001	body length (VT:0001256)	body length (CMO:0000013)	1	1	32356093	Rat
2313069	Bss68	Bone structure and strength QTL 68	2.9	0.0001	tibia size trait (VT:0100001)	tibia total energy absorbed before break (CMO:0001736)	1	11481312	82174945	Rat
2313075	Bss66	Bone structure and strength QTL 66	3.4	0.0001	tibia length (VT:0004357)	tibia length (CMO:0000450)	1	11481312	82174945	Rat
2298546	Neuinf4	Neuroinflammation QTL 4	5.1		nervous system integrity trait (VT:0010566)	spinal cord RT1-B protein level (CMO:0002132)	1	1	28736750	Rat
1300167	Hrtrt2	Heart rate QTL 2	4.35		heart pumping trait (VT:2000009)	heart rate (CMO:0000002)	1	11481312	75088344	Rat
2313077	Bss69	Bone structure and strength QTL 69	3.5	0.0001	tibia strength trait (VT:1000284)	bone polar moment of inertia (CMO:0001558)	1	11481312	82174945	Rat
2317755	Glom22	Glomerulus QTL 22	3.8		urine protein amount (VT:0005160)	urine protein level (CMO:0000591)	1	11481482	32355910	Rat
1578756	Iddm22	Insulin dependent diabetes mellitus QTL 22	2.7		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	1	11835181	56835181	Rat
631508	Sald1	Serum aldosterone level QTL 1	3.7		blood aldosterone amount (VT:0005346)	serum aldosterone level (CMO:0000487)	1	9856001	54856001	Rat
2313090	Bmd69	Bone mineral density QTL 69	4.4	0.0001	tibia mineral mass (VT:1000283)	compact volumetric bone mineral density (CMO:0001730)	1	1	32356093	Rat
4889451	Eae29	Experimental allergic encephalomyelitis QTL 29	5.51		nervous system integrity trait (VT:0010566)	experimental autoimmune encephalomyelitis severity score (CMO:0001419)	1	5925877	24697545	Rat
2313092	Bmd72	Bone mineral density QTL 72	2.5	0.0001	tibia mineral mass (VT:1000283)	total volumetric bone mineral density (CMO:0001728)	1	11481312	82174945	Rat
2313097	Bss70	Bone structure and strength QTL 70	3.5	0.0001	tibia strength trait (VT:1000284)	tibia total energy absorbed before break (CMO:0001736)	1	11481312	82174945	Rat
738020	Pia8	Pristane induced arthritis QTL 8	4.7		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	1	1	65833076	Rat
1600360	Mcs16	Mammary carcinoma susceptibility QTL 16	2.4		mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	1	2244390	43433040	Rat
1578669	Bss9	Bone structure and strength QTL 9	6.3		femur morphology trait (VT:0000559)	bone trabecular cross-sectional area (CMO:0002311)	1	509108	43284926	Rat
2302038	Pia31	Pristane induced arthritis QTL 31	5.5	0.001	blood autoantibody amount (VT:0003725)	serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)	1	10992065	55992065	Rat
2313053	Bss51	Bone structure and strength QTL 51	3.8	0.0001	tibia length (VT:0004357)	tibia length (CMO:0000450)	1	1	32356093	Rat

Database	Acc Id	Source(s)
NCBI Gene	140929	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailable


InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailable


Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
		Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable

Create Name:

Description:

Send us a Message

Marker: D1Ztm8