Symbol:
Tmod3
Name:
tropomodulin 3
RGD ID:
1311030
Description:
Predicted to enable tropomyosin binding activity. Predicted to be involved in pointed-end actin filament capping. Predicted to act upstream of or within actin cytoskeleton organization; erythrocyte development; and positive regulation of mitotic cell cycle phase transition. Predicted to be located in striated muscle thin filament. Orthologous to human TMOD3 (tropomodulin 3); INTERACTS WITH (+)-schisandrin B; 2,3,7,8-tetrachlorodibenzodioxine; 2,4-dinitrotoluene.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
LOC300838; tropomodulin-3
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
TMOD3 (tropomodulin 3) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):
Tmod3 (tropomodulin 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
TMOD3 (tropomodulin 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Other homologs 2
Homo sapiens (human):
STIP1 (stress induced phosphoprotein 1) HGNC
OMA
Alliance orthologs 3
Homo sapiens (human):
TMOD3 (tropomodulin 3)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Tmod3 (tropomodulin 3)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
tmod2 (tropomodulin 2)
Alliance
DIOPT (Ensembl Compara|Hieranoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB)
Drosophila melanogaster (fruit fly):
tmod
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Caenorhabditis elegans (roundworm):
unc-94
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
tmod3
Alliance
DIOPT (Ensembl Compara|OMA|OrthoFinder|PANTHER|PhylomeDB)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 8 85,131,295 - 85,191,477 (-) NCBI GRCr8 mRatBN7.2 8 76,248,978 - 76,310,855 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 8 76,248,979 - 76,310,977 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 8 81,758,229 - 81,818,417 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 8 80,023,230 - 80,083,483 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 8 77,857,563 - 77,917,754 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 8 82,432,165 - 82,492,243 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 8 82,432,169 - 82,492,243 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 8 82,035,308 - 82,095,422 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 8 80,317,882 - 80,377,994 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 8 80,336,938 - 80,397,048 (-) NCBI Celera 8 76,040,427 - 76,100,486 (-) NCBI Celera Cytogenetic Map 8 q24 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Tmod3 Rat (+)-schisandrin B multiple interactions EXP 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in increased expression of TMOD3 mRNA] CTD PMID:31150632 Tmod3 Rat 1,2-dimethylhydrazine decreases expression ISO Tmod3 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in decreased expression of TMOD3 mRNA CTD PMID:22206623 Tmod3 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO Tmod3 (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in decreased expression of TMOD3 mRNA CTD PMID:19465110 Tmod3 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of TMOD3 mRNA CTD PMID:34747641 Tmod3 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Tmod3 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of TMOD3 mRNA CTD PMID:21570461 Tmod3 Rat 2,4-dinitrotoluene affects expression EXP 6480464 2 and 4-dinitrotoluene affects the expression of TMOD3 mRNA CTD PMID:21346803 Tmod3 Rat 2,6-dimethoxyphenol multiple interactions ISO TMOD3 (Homo sapiens) 6480464 [Sodium Chloride co-treated with pyrogallol 1 more ... CTD PMID:38598786 Tmod3 Rat 4,4'-sulfonyldiphenol increases expression ISO TMOD3 (Homo sapiens) 6480464 bisphenol S results in increased expression of TMOD3 protein CTD PMID:34186270 Tmod3 Rat aristolochic acid A decreases expression ISO TMOD3 (Homo sapiens) 6480464 aristolochic acid I results in decreased expression of TMOD3 mRNA CTD PMID:33212167 Tmod3 Rat benzo[a]pyrene increases expression ISO Tmod3 (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of TMOD3 mRNA CTD PMID:22228805 Tmod3 Rat benzo[a]pyrene affects methylation ISO TMOD3 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of TMOD3 5' UTR and Benzo(a)pyrene affects the methylation of TMOD3 promoter CTD PMID:27901495 Tmod3 Rat benzo[a]pyrene decreases expression ISO TMOD3 (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased expression of TMOD3 protein CTD PMID:32717239 Tmod3 Rat benzo[a]pyrene diol epoxide I decreases expression ISO TMOD3 (Homo sapiens) 6480464 7 more ... CTD PMID:20018196 Tmod3 Rat Benzo[ghi]perylene increases expression ISO Tmod3 (Mus musculus) 6480464 1 and 12-benzoperylene results in increased expression of TMOD3 mRNA CTD PMID:26377693 Tmod3 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of TMOD3 mRNA CTD PMID:25181051 Tmod3 Rat bisphenol A decreases expression ISO TMOD3 (Homo sapiens) 6480464 bisphenol A results in decreased expression of TMOD3 protein CTD PMID:37567409 Tmod3 Rat bisphenol A increases expression ISO TMOD3 (Homo sapiens) 6480464 bisphenol A results in increased expression of TMOD3 protein CTD PMID:34186270 Tmod3 Rat bisphenol A decreases methylation ISO TMOD3 (Homo sapiens) 6480464 bisphenol A results in decreased methylation of TMOD3 gene CTD PMID:31601247 Tmod3 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of TMOD3 mRNA CTD PMID:34947998 Tmod3 Rat bisphenol AF increases expression ISO TMOD3 (Homo sapiens) 6480464 bisphenol AF results in increased expression of TMOD3 protein CTD PMID:34186270 Tmod3 Rat Bisphenol B increases expression ISO TMOD3 (Homo sapiens) 6480464 bisphenol B results in increased expression of TMOD3 protein CTD PMID:34186270 Tmod3 Rat bisphenol F increases expression ISO Tmod3 (Mus musculus) 6480464 bisphenol F results in increased expression of TMOD3 mRNA CTD PMID:38685157 Tmod3 Rat bisphenol F increases expression ISO TMOD3 (Homo sapiens) 6480464 bisphenol F results in increased expression of TMOD3 protein CTD PMID:34186270 Tmod3 Rat bufalin decreases expression ISO TMOD3 (Homo sapiens) 6480464 bufalin results in decreased expression of TMOD3 protein CTD PMID:23091618 Tmod3 Rat caffeine affects phosphorylation ISO TMOD3 (Homo sapiens) 6480464 Caffeine affects the phosphorylation of TMOD3 protein CTD PMID:35688186 Tmod3 Rat copper(II) sulfate increases expression ISO TMOD3 (Homo sapiens) 6480464 Copper Sulfate results in increased expression of TMOD3 mRNA CTD PMID:19549813 Tmod3 Rat CU-O LINKAGE increases expression ISO TMOD3 (Homo sapiens) 6480464 cupric oxide results in increased expression of TMOD3 protein CTD PMID:25470785 Tmod3 Rat cyclosporin A increases expression ISO TMOD3 (Homo sapiens) 6480464 Cyclosporine results in increased expression of TMOD3 mRNA CTD PMID:25562108 Tmod3 Rat DDE decreases expression ISO TMOD3 (Homo sapiens) 6480464 Dichlorodiphenyl Dichloroethylene results in decreased expression of TMOD3 mRNA CTD PMID:38568856 Tmod3 Rat Dibutyl phosphate affects expression ISO TMOD3 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of TMOD3 mRNA CTD PMID:37042841 Tmod3 Rat dibutyl phthalate increases expression ISO Tmod3 (Mus musculus) 6480464 Dibutyl Phthalate results in increased expression of TMOD3 mRNA CTD PMID:21266533 Tmod3 Rat dorsomorphin multiple interactions ISO TMOD3 (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TMOD3 mRNA CTD PMID:27188386 Tmod3 Rat doxorubicin decreases expression ISO TMOD3 (Homo sapiens) 6480464 Doxorubicin results in decreased expression of TMOD3 mRNA CTD PMID:29803840 Tmod3 Rat enzyme inhibitor multiple interactions ISO TMOD3 (Homo sapiens) 6480464 [Enzyme Inhibitors results in decreased activity of OGA protein] which results in increased O-linked glycosylation of TMOD3 protein CTD PMID:23301498 Tmod3 Rat flutamide increases expression EXP 6480464 Flutamide results in increased expression of TMOD3 mRNA CTD PMID:24136188 Tmod3 Rat folic acid decreases expression ISO Tmod3 (Mus musculus) 6480464 Folic Acid results in decreased expression of TMOD3 mRNA CTD PMID:25629700 Tmod3 Rat FR900359 increases phosphorylation ISO TMOD3 (Homo sapiens) 6480464 FR900359 results in increased phosphorylation of TMOD3 protein CTD PMID:37730182 Tmod3 Rat furfural multiple interactions ISO TMOD3 (Homo sapiens) 6480464 [Sodium Chloride co-treated with Furaldehyde] results in increased expression of TMOD3 protein CTD PMID:38598786 Tmod3 Rat geldanamycin increases expression ISO TMOD3 (Homo sapiens) 6480464 geldanamycin results in increased expression of TMOD3 mRNA CTD PMID:26705709 Tmod3 Rat haloperidol decreases expression ISO TMOD3 (Homo sapiens) 6480464 Haloperidol results in decreased expression of TMOD3 protein CTD PMID:34122009 Tmod3 Rat inulin multiple interactions ISO Tmod3 (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Inulin] results in decreased expression of TMOD3 mRNA CTD PMID:36331819 Tmod3 Rat methoxychlor affects methylation EXP 6480464 Methoxychlor affects the methylation of TMOD3 gene CTD PMID:35440735 Tmod3 Rat nitrates multiple interactions ISO Tmod3 (Mus musculus) 6480464 [Particulate Matter results in increased abundance of Nitrates] which results in increased expression of TMOD3 mRNA CTD PMID:35964746 Tmod3 Rat ozone multiple interactions ISO TMOD3 (Homo sapiens) 6480464 [Air Pollutants results in increased abundance of Ozone] which affects the expression of TMOD3 mRNA CTD PMID:35430440 Tmod3 Rat paracetamol increases expression ISO TMOD3 (Homo sapiens) 6480464 Acetaminophen results in increased expression of TMOD3 mRNA CTD PMID:22230336 Tmod3 Rat paracetamol decreases expression EXP 6480464 Acetaminophen results in decreased expression of TMOD3 mRNA CTD PMID:33387578 Tmod3 Rat perfluorooctane-1-sulfonic acid multiple interactions ISO Tmod3 (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Inulin] results in decreased expression of TMOD3 mRNA CTD PMID:36331819 Tmod3 Rat phenobarbital affects expression ISO Tmod3 (Mus musculus) 6480464 Phenobarbital affects the expression of TMOD3 mRNA CTD PMID:23091169 Tmod3 Rat phenobarbital affects expression ISO TMOD3 (Homo sapiens) 6480464 Phenobarbital affects the expression of TMOD3 mRNA CTD PMID:19159669 Tmod3 Rat phenylmercury acetate multiple interactions ISO TMOD3 (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TMOD3 mRNA CTD PMID:27188386 Tmod3 Rat phenylmercury acetate increases expression ISO TMOD3 (Homo sapiens) 6480464 Phenylmercuric Acetate results in increased expression of TMOD3 mRNA CTD PMID:26272509 Tmod3 Rat potassium chromate decreases expression ISO TMOD3 (Homo sapiens) 6480464 potassium chromate(VI) results in decreased expression of TMOD3 mRNA CTD PMID:22714537 Tmod3 Rat SB 431542 multiple interactions ISO TMOD3 (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TMOD3 mRNA CTD PMID:27188386 Tmod3 Rat silver atom decreases expression ISO Tmod3 (Mus musculus) 6480464 Silver results in decreased expression of TMOD3 mRNA CTD PMID:27131904 Tmod3 Rat silver(0) decreases expression ISO Tmod3 (Mus musculus) 6480464 Silver results in decreased expression of TMOD3 mRNA CTD PMID:27131904 Tmod3 Rat sodium chloride multiple interactions ISO TMOD3 (Homo sapiens) 6480464 [Sodium Chloride co-treated with Furaldehyde] results in increased expression of TMOD3 protein more ... CTD PMID:38598786 Tmod3 Rat Soman increases expression EXP 6480464 Soman results in increased expression of TMOD3 mRNA CTD PMID:19281266 Tmod3 Rat tetrachloromethane multiple interactions EXP 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in increased expression of TMOD3 mRNA] CTD PMID:31150632 Tmod3 Rat tetrachloromethane increases expression EXP 6480464 Carbon Tetrachloride results in increased expression of TMOD3 mRNA CTD PMID:31150632 Tmod3 Rat thioacetamide increases expression EXP 6480464 Thioacetamide results in increased expression of TMOD3 mRNA CTD PMID:34492290 Tmod3 Rat titanium dioxide decreases methylation ISO Tmod3 (Mus musculus) 6480464 titanium dioxide results in decreased methylation of TMOD3 gene CTD PMID:35295148 Tmod3 Rat triphenyl phosphate affects expression ISO TMOD3 (Homo sapiens) 6480464 triphenyl phosphate affects the expression of TMOD3 mRNA CTD PMID:37042841 Tmod3 Rat urethane increases expression ISO TMOD3 (Homo sapiens) 6480464 Urethane results in increased expression of TMOD3 mRNA CTD PMID:28818685 Tmod3 Rat vancomycin decreases expression ISO Tmod3 (Mus musculus) 6480464 Vancomycin results in decreased expression of TMOD3 mRNA CTD PMID:18930951 Tmod3 Rat vinclozolin affects expression EXP 6480464 vinclozolin affects the expression of TMOD3 mRNA CTD PMID:19015723
(+)-schisandrin B (EXP) 1,2-dimethylhydrazine (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4-dinitrotoluene (EXP) 2,6-dimethoxyphenol (ISO) 4,4'-sulfonyldiphenol (ISO) aristolochic acid A (ISO) benzo[a]pyrene (ISO) benzo[a]pyrene diol epoxide I (ISO) Benzo[ghi]perylene (ISO) bisphenol A (EXP,ISO) bisphenol AF (ISO) Bisphenol B (ISO) bisphenol F (ISO) bufalin (ISO) caffeine (ISO) copper(II) sulfate (ISO) CU-O LINKAGE (ISO) cyclosporin A (ISO) DDE (ISO) Dibutyl phosphate (ISO) dibutyl phthalate (ISO) dorsomorphin (ISO) doxorubicin (ISO) enzyme inhibitor (ISO) flutamide (EXP) folic acid (ISO) FR900359 (ISO) furfural (ISO) geldanamycin (ISO) haloperidol (ISO) inulin (ISO) methoxychlor (EXP) nitrates (ISO) ozone (ISO) paracetamol (EXP,ISO) perfluorooctane-1-sulfonic acid (ISO) phenobarbital (ISO) phenylmercury acetate (ISO) potassium chromate (ISO) SB 431542 (ISO) silver atom (ISO) silver(0) (ISO) sodium chloride (ISO) Soman (EXP) tetrachloromethane (EXP) thioacetamide (EXP) titanium dioxide (ISO) triphenyl phosphate (ISO) urethane (ISO) vancomycin (ISO) vinclozolin (EXP)
Tmod3 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 8 85,131,295 - 85,191,477 (-) NCBI GRCr8 mRatBN7.2 8 76,248,978 - 76,310,855 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 8 76,248,979 - 76,310,977 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 8 81,758,229 - 81,818,417 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 8 80,023,230 - 80,083,483 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 8 77,857,563 - 77,917,754 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 8 82,432,165 - 82,492,243 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 8 82,432,169 - 82,492,243 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 8 82,035,308 - 82,095,422 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 8 80,317,882 - 80,377,994 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 8 80,336,938 - 80,397,048 (-) NCBI Celera 8 76,040,427 - 76,100,486 (-) NCBI Celera Cytogenetic Map 8 q24 NCBI
TMOD3 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 15 51,829,653 - 51,915,725 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 15 51,829,628 - 51,947,295 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 15 52,121,850 - 52,207,922 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Cytogenetic Map 15 q21.2 NCBI HuRef 15 28,952,327 - 29,034,886 (+) NCBI HuRef CHM1_1 15 52,239,893 - 52,322,383 (+) NCBI CHM1_1 T2T-CHM13v2.0 15 49,637,162 - 49,723,313 (+) NCBI T2T-CHM13v2.0
Tmod3 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 9 75,405,066 - 75,466,939 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 9 75,404,989 - 75,466,939 (-) Ensembl GRCm39 Ensembl GRCm38 9 75,497,784 - 75,559,657 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 9 75,497,707 - 75,559,657 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 9 75,345,591 - 75,407,464 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 9 75,283,693 - 75,345,566 (-) NCBI MGSCv36 mm8 Celera 9 72,658,788 - 72,720,531 (-) NCBI Celera Cytogenetic Map 9 D NCBI cM Map 9 42.3 NCBI
TMOD3 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 1 119,862,244 - 119,948,880 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 1 119,864,878 - 119,948,795 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 1 132,955,318 - 133,000,013 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
.
Predicted Target Of
Count of predictions: 75 Count of miRNA genes: 66 Interacting mature miRNAs: 71 Transcripts: ENSRNOT00000013852 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
1554321 Bmd3 Bone mineral density QTL 3 7.9 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 8 49849908 118871671 Rat 9590292 Uminl3 Urine mineral level QTL 3 3.62 0.001 urine mineral amount (VT:0015086) urine electrolyte level (CMO:0000593) 8 80768445 125768445 Rat 1578769 Uae31 Urinary albumin excretion QTL 31 3.3 0.001 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 8 39106363 103375781 Rat 1298079 Activ2 Activity QTL 2 9.5 0.000001 voluntary movement trait (VT:0003491) rearing measurement (CMO:0001515) 8 50763951 95763951 Rat 70161 Bp62 Blood pressure QTL 62 2.9 0.001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 8 51589699 99045312 Rat 1578765 Klgr1 Kidney lesion grade QTL 1 3.3 0.0001 kidney morphology trait (VT:0002135) organ lesion measurement (CMO:0000677) 8 39106363 103375781 Rat 61464 Niddm11 Non-insulin dependent diabetes mellitus QTL 11 3.1 0.001 blood insulin amount (VT:0001560) plasma insulin level (CMO:0000342) 8 44477926 89477926 Rat 4889938 Bss89 Bone structure and strength QTL 89 3.8 tibia size trait (VT:0100001) tibia cortical bone volume (CMO:0001725) 8 58991697 91341052 Rat 1578755 Pur5 Proteinuria QTL 5 3.3 0.0001 urine total protein amount (VT:0000032) urine total protein excretion rate (CMO:0000756) 8 39106258 103375958 Rat 2313088 Bss75 Bone structure and strength QTL 75 3.1 0.0001 body length (VT:0001256) body length, nose to rump (CMO:0000079) 8 39106258 91341052 Rat 631210 Bw3 Body weight QTL3 5.9 mesenteric fat pad mass (VT:0010427) mesenteric fat pad weight to body weight ratio (CMO:0000654) 8 61019838 121662124 Rat 8662823 Vetf5 Vascular elastic tissue fragility QTL 5 1.9 artery integrity trait (VT:0010639) patent ductus arteriosus score (CMO:0002566) 8 63404444 108404444 Rat 1358896 Bp262 Blood pressure QTL 262 2.89 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 8 35464071 107982864 Rat 731182 Uae24 Urinary albumin excretion QTL 24 6.4 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 8 47541419 92541419 Rat 8694446 Bw170 Body weight QTL 170 12.07 0.001 retroperitoneal fat pad mass (VT:0010430) retroperitoneal fat pad weight to body weight ratio (CMO:0000635) 8 80768445 125768445 Rat 1331769 Rf39 Renal function QTL 39 3.871 urine output (VT:0003620) timed urine volume (CMO:0000260) 8 50763951 107970527 Rat 61358 Bp39 Blood pressure QTL 39 2 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 8 44447837 89447837 Rat 1358906 Bp253 Blood pressure QTL 253 4 0.0004 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 8 49610204 94610204 Rat 10450865 Bw175 Body weight QTL 175 4.1 total fat pad mass (VT:0015008) adipose tissue molecular composition measurement (CMO:0000484) 8 84192326 129192326 Rat 1358907 Cm40 Cardiac mass QTL 40 1.89 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 8 35464071 107982864 Rat 70197 BpQTLcluster8 Blood pressure QTL cluster 8 3.482 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 8 55428333 127966348 Rat 2316950 Scl66 Serum cholesterol level QTL 66 4.1 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 8 39106363 114525825 Rat 1582254 Kidm31 Kidney mass QTL 31 3 kidney mass (VT:0002707) both kidneys wet weight (CMO:0000085) 8 49245178 94245178 Rat 724540 Uae8 Urinary albumin excretion QTL 8 5 urine albumin amount (VT:0002871) urine albumin level (CMO:0000130) 8 39106258 103375958 Rat 10402857 Bp380 Blood pressure QTL 380 0.95 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 8 62848139 107848139 Rat 1358892 Kidm26 Kidney mass QTL 26 3.69 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 8 35464071 107982864 Rat 1582243 Bw66 Body weight QTL 66 3.4 0.0048 body mass (VT:0001259) body weight (CMO:0000012) 8 49245178 94245178 Rat 5684973 Bss100 Bone structure and strength QTL 100 4.7 tibia area (VT:1000281) tibia area measurement (CMO:0001382) 8 58991697 91341052 Rat 8694200 Abfw4 Abdominal fat weight QTL 4 9.07 0.001 visceral adipose mass (VT:0010063) abdominal fat pad weight to body weight ratio (CMO:0000095) 8 80768445 125768445 Rat 61373 Mcs4 Mammary carcinoma susceptibility QTL 4 1.1 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 8 44475043 89475043 Rat 2313057 Bss76 Bone structure and strength QTL 76 3 0.0001 tibia size trait (VT:0100001) tibia midshaft cross-sectional area (CMO:0001717) 8 39106258 91341052 Rat 12879878 Bw183 Body weight QTL 183 0.001 body mass (VT:0001259) body weight (CMO:0000012) 8 62848139 107848139 Rat 1300177 Cm2 Cardiac mass QTL 2 3.65 heart mass (VT:0007028) heart weight (CMO:0000017) 8 63141536 109261840 Rat 1549909 Stresp11 Stress response QTL 11 6.83 0.0019 stress-related behavior trait (VT:0010451) number of approaches toward negative stimulus before onset of defensive burying response (CMO:0001960) 8 82352698 127352698 Rat 1549908 Neudeg1 Neurodegradation QTL 1 5.5 0 nervous system integrity trait (VT:0010566) logarithm of the ratio of the lesioned side motor neuron count to contralateral side motor neuron count (CMO:0001986) 8 58337123 103337123 Rat 12879879 Cm99 Cardiac mass QTL 99 0.001 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 8 62848139 107848139 Rat 2313067 Bss77 Bone structure and strength QTL 77 3.1 0.0001 tibia size trait (VT:0100001) tibia midshaft endosteal cross-sectional area (CMO:0001716) 8 39106258 91341052 Rat 1331804 Cm30 Cardiac mass QTL 30 3.77443 heart mass (VT:0007028) heart wet weight (CMO:0000069) 8 62970527 107970527 Rat 12879880 Cm100 Cardiac mass QTL 100 0.001 heart left ventricle mass (VT:0007031) heart left ventricle weight to body weight ratio (CMO:0000530) 8 62848139 107848139 Rat 12879881 Cm101 Cardiac mass QTL 101 0.001 heart right ventricle mass (VT:0007033) heart right ventricle weight to body weight ratio (CMO:0000914) 8 62848139 107848139 Rat 12879882 Am8 Aortic mass QTL 8 0.001 aorta mass (VT:0002845) aorta weight to aorta length to body weight ratio (CMO:0002722) 8 62848139 107848139 Rat 12879883 Kidm65 Kidney mass QTL 65 0.001 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 8 62848139 107848139 Rat 71120 Niddm21 Non-insulin dependent diabetes mellitus QTL 21 3.73 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 8 66992095 111992095 Rat 1358912 Bw51 Body weight QTL 51 2.95 body mass (VT:0001259) body weight (CMO:0000012) 8 60248093 105248093 Rat 634332 Pia18 Pristane induced arthritis QTL 18 4 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 8 84192326 132782436 Rat 1300171 Bp184 Blood pressure QTL 184 3.66 arterial blood pressure trait (VT:2000000) blood pressure time series experimental set point of the baroreceptor response (CMO:0002593) 8 79394435 132782436 Rat 2313086 Bss60 Bone structure and strength QTL 60 4.1 0.0001 tibia length (VT:0004357) tibia length (CMO:0000450) 8 58991697 91341052 Rat 2293697 Bmd39 Bone mineral density QTL 39 femur strength trait (VT:0010010) femur total energy absorbed before break (CMO:0001677) 8 62848139 107848139 Rat 1331837 Bw23 Body weight QTL 23 4.19 0.00007 body mass (VT:0001259) body weight (CMO:0000012) 8 55428416 107963099 Rat 1331838 Niddm61 Non-insulin dependent diabetes mellitus QTL 61 3.53 0.0004 blood insulin amount (VT:0001560) plasma insulin level (CMO:0000342) 8 62963099 107963099 Rat 631650 Stl6 Serum triglyceride level QTL 6 4 0.0019 blood triglyceride amount (VT:0002644) plasma triglyceride level (CMO:0000548) 8 70041301 121080908 Rat 1581557 Eae16 Experimental allergic encephalomyelitis QTL 16 3.8 nervous system integrity trait (VT:0010566) experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046) 8 68690349 119799881 Rat 2313046 Bss78 Bone structure and strength QTL 78 3.5 0.0001 tibia strength trait (VT:1000284) tibia total energy absorbed before break (CMO:0001736) 8 39106258 91341052 Rat 2301402 Bp316 Blood pressure QTL 316 0.005 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 8 62848139 107848139 Rat 631664 Hcar3 Hepatocarcinoma resistance QTL 3 2.9 0.0005 liver integrity trait (VT:0010547) volume of individual liver tumorous lesion (CMO:0001078) 8 62982864 107982864 Rat 8694392 Bw161 Body weight QTL 161 8.06 0.001 body lean mass (VT:0010483) lean tissue morphological measurement (CMO:0002184) 8 80768445 125768445 Rat
RH129438
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 8 76,251,005 - 76,251,215 (+) MAPPER mRatBN7.2 Rnor_6.0 8 82,432,364 - 82,432,573 NCBI Rnor6.0 Rnor_5.0 8 82,035,507 - 82,035,716 UniSTS Rnor5.0 RGSC_v3.4 8 80,318,081 - 80,318,290 UniSTS RGSC3.4 Celera 8 76,040,626 - 76,040,835 UniSTS Cytogenetic Map 8 q24 UniSTS
RH129766
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 8 76,250,844 - 76,251,024 (+) MAPPER mRatBN7.2 Rnor_6.0 8 82,432,203 - 82,432,382 NCBI Rnor6.0 Rnor_5.0 8 82,035,346 - 82,035,525 UniSTS Rnor5.0 RGSC_v3.4 8 80,317,920 - 80,318,099 UniSTS RGSC3.4 Celera 8 76,040,465 - 76,040,644 UniSTS Cytogenetic Map 8 q24 UniSTS
BF404332
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 8 76,283,623 - 76,283,816 (+) MAPPER mRatBN7.2 Rnor_6.0 8 82,465,010 - 82,465,202 NCBI Rnor6.0 Rnor_5.0 8 82,068,165 - 82,068,357 UniSTS Rnor5.0 RGSC_v3.4 8 80,350,738 - 80,350,930 UniSTS RGSC3.4 Celera 8 76,073,247 - 76,073,439 UniSTS RH 3.4 Map 8 896.49 UniSTS Cytogenetic Map 8 q24 UniSTS
RH138160
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 8 76,274,058 - 76,274,193 (+) MAPPER mRatBN7.2 Rnor_6.0 8 82,455,445 - 82,455,579 NCBI Rnor6.0 Rnor_5.0 8 82,058,600 - 82,058,734 UniSTS Rnor5.0 RGSC_v3.4 8 80,341,172 - 80,341,306 UniSTS RGSC3.4 Celera 8 76,063,680 - 76,063,814 UniSTS Cytogenetic Map 8 q24 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000013852 ⟹ ENSRNOP00000013852
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 8 76,256,102 - 76,310,977 (-) Ensembl Rnor_6.0 Ensembl 8 82,432,169 - 82,492,243 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000103318 ⟹ ENSRNOP00000091060
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 8 76,248,979 - 76,310,962 (-) Ensembl
RefSeq Acc Id:
NM_001011997 ⟹ NP_001011997
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 8 85,131,295 - 85,191,341 (-) NCBI mRatBN7.2 8 76,250,807 - 76,310,855 (-) NCBI Rnor_6.0 8 82,432,165 - 82,492,243 (-) NCBI Rnor_5.0 8 82,035,308 - 82,095,422 (-) NCBI RGSC_v3.4 8 80,317,882 - 80,377,994 (-) RGD Celera 8 76,040,427 - 76,100,486 (-) RGD
Sequence:
CGGACTGTGCAGTGGGTCGGCGGCCAGACAGCTATAAGAAGTCGTGGAAGGAGCCGGCGACTGCCGACACTGAGCCATGGCACTGCCGTTCCGGAAAGACTTGGGAGACTATAAGGACCTGGATGAGG
hide sequence
RefSeq Acc Id:
XM_039081147 ⟹ XP_038937075
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 8 85,131,295 - 85,147,208 (-) NCBI mRatBN7.2 8 76,248,978 - 76,267,539 (-) NCBI
RefSeq Acc Id:
XM_063265181 ⟹ XP_063121251
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 8 85,131,295 - 85,191,477 (-) NCBI
RefSeq Acc Id:
NP_001011997 ⟸ NM_001011997
- UniProtKB:
Q6AXW2 (UniProtKB/TrEMBL), A6I1D5 (UniProtKB/TrEMBL), F7F0R0 (UniProtKB/TrEMBL), A0A8I6GJC0 (UniProtKB/TrEMBL)
- Sequence:
MALPFRKDLGDYKDLDEDELLGKLSESELKQLETVLDDLDPENALLPAGFRQKNQTSKSATGPFDRERLLSYLEKEALEYKDREDYVPYTGEKKGKIFIPKQKPVQTFTEETISLDPELEEALTSASD
hide sequence
Ensembl Acc Id:
ENSRNOP00000013852 ⟸ ENSRNOT00000013852
RefSeq Acc Id:
XP_038937075 ⟸ XM_039081147
- Peptide Label:
isoform X2
Ensembl Acc Id:
ENSRNOP00000091060 ⟸ ENSRNOT00000103318
RefSeq Acc Id:
XP_063121251 ⟸ XM_063265181
- Peptide Label:
isoform X1
- UniProtKB:
A0A8I6GJC0 (UniProtKB/TrEMBL), A6I1D5 (UniProtKB/TrEMBL), Q6AXW2 (UniProtKB/TrEMBL), F7F0R0 (UniProtKB/TrEMBL)
RGD ID: 13696130 Promoter ID: EPDNEW_R6655 Type: initiation region Name: Tmod3_1 Description: tropomodulin 3 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 8 82,492,323 - 82,492,383 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2005-12-06
Tmod3
tropomodulin 3
Tmod3_predicted
tropomodulin 3 (predicted)
Symbol and Name updated
1559027 APPROVED
2005-01-12
Tmod3_predicted
tropomodulin 3 (predicted)
Symbol and Name status set to approved
70820 APPROVED
