Symbol:
Afm
Name:
afamin
RGD ID:
735381
MGI Page
MGI
Description:
Predicted to enable vitamin E binding activity. Predicted to be involved in protein stabilization; protein transport within extracellular region; and vitamin transport. Predicted to be located in extracellular space. Predicted to be active in cytoplasm. Is expressed in several structures, including gut; liver; and metanephros. Orthologous to human AFM (afamin).
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
A; Alf; alpha albumin; alpha-Alb; alpha-albumin; MGC118711
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
AFM (afamin) HGNC
EggNOG, Ensembl, HGNC, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Rattus norvegicus (Norway rat):
Afm (afamin) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
AFM (afamin) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
AFM (afamin) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
AFM (afamin) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
AFM (afamin) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Afm (afamin) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Rattus norvegicus (Norway rat):
Afm (afamin)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Homo sapiens (human):
AFM (afamin)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 5 90,666,808 - 90,701,403 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 5 90,666,791 - 90,701,402 (+) Ensembl GRCm39 Ensembl GRCm38 5 90,518,949 - 90,553,544 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 5 90,518,932 - 90,553,543 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 5 90,947,975 - 90,982,570 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 5 91,594,163 - 91,641,425 (+) NCBI MGSCv36 mm8 Celera 5 88,680,306 - 88,704,975 (+) NCBI Celera Cytogenetic Map 5 E1 NCBI cM Map 5 44.78 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Afm Mouse (+)-schisandrin B multiple interactions ISO Afm (Rattus norvegicus) 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in decreased expression of AFM mRNA] CTD PMID:31150632 Afm Mouse (1->4)-beta-D-glucan multiple interactions EXP 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of AFM mRNA CTD PMID:36331819 Afm Mouse 1,2-dimethylhydrazine decreases expression EXP 6480464 1 and 2-Dimethylhydrazine results in decreased expression of AFM mRNA CTD PMID:22206623 Afm Mouse 1-naphthyl isothiocyanate decreases expression ISO Afm (Rattus norvegicus) 6480464 1-Naphthylisothiocyanate results in decreased expression of AFM mRNA CTD PMID:25380136 and PMID:30723492 Afm Mouse 17beta-estradiol decreases expression ISO AFM (Homo sapiens) 6480464 Estradiol results in decreased expression of AFM mRNA CTD PMID:20106945 Afm Mouse 17beta-estradiol decreases expression EXP 6480464 Estradiol results in decreased expression of AFM mRNA CTD PMID:39298647 Afm Mouse 17beta-estradiol increases expression ISO Afm (Rattus norvegicus) 6480464 Estradiol results in increased expression of AFM mRNA CTD PMID:32145629 Afm Mouse 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of AFM mRNA CTD PMID:19770486 Afm Mouse 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO AFM (Homo sapiens) 6480464 Tetrachlorodibenzodioxin results in decreased expression of AFM mRNA CTD PMID:20106945 and PMID:26159488 Afm Mouse 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO AFM (Homo sapiens) 6480464 [Endosulfan co-treated with Tetrachlorodibenzodioxin] results in decreased expression of AFM mRNA CTD PMID:26159488 Afm Mouse 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO Afm (Rattus norvegicus) 6480464 Tetrachlorodibenzodioxin results in decreased expression of AFM mRNA CTD PMID:20959002 more ... Afm Mouse 2,4-dibromophenyl 2,4,5-tribromophenyl ether affects expression EXP 6480464 2 more ... CTD PMID:38648751 Afm Mouse 2,4-dinitrotoluene affects expression ISO Afm (Rattus norvegicus) 6480464 2 and 4-dinitrotoluene affects the expression of AFM mRNA CTD PMID:21346803 Afm Mouse 2,6-dinitrotoluene affects expression ISO Afm (Rattus norvegicus) 6480464 2 and 6-dinitrotoluene affects the expression of AFM mRNA CTD PMID:21346803 Afm Mouse 3,3',4,4',5-pentachlorobiphenyl decreases expression ISO Afm (Rattus norvegicus) 6480464 3 more ... CTD PMID:20959002 Afm Mouse 4,4'-diaminodiphenylmethane decreases expression ISO Afm (Rattus norvegicus) 6480464 4 and 4'-diaminodiphenylmethane results in decreased expression of AFM mRNA CTD PMID:25380136 Afm Mouse 4,4'-diaminodiphenylmethane increases expression EXP 6480464 4 and 4'-diaminodiphenylmethane results in increased expression of AFM mRNA CTD PMID:18648102 Afm Mouse 4,4'-sulfonyldiphenol decreases expression EXP 6480464 bisphenol S results in decreased expression of AFM mRNA CTD PMID:39298647 Afm Mouse 5-methoxy-2-\{[(4-methoxy-3,5-dimethylpyridin-2-yl)methyl]sulfinyl\}-1H-benzimidazole affects expression ISO Afm (Rattus norvegicus) 6480464 Omeprazole affects the expression of AFM mRNA CTD PMID:19483382 Afm Mouse 6-propyl-2-thiouracil affects expression ISO Afm (Rattus norvegicus) 6480464 Propylthiouracil affects the expression of AFM mRNA CTD PMID:19483382 Afm Mouse aflatoxin B1 affects expression ISO AFM (Homo sapiens) 6480464 Aflatoxin B1 affects the expression of AFM protein CTD PMID:20106945 Afm Mouse aflatoxin B1 decreases methylation ISO AFM (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of AFM gene CTD PMID:27153756 Afm Mouse aflatoxin B1 decreases expression ISO AFM (Homo sapiens) 6480464 Aflatoxin B1 results in decreased expression of AFM mRNA CTD PMID:21641981 and PMID:27153756 Afm Mouse aflatoxin B1 decreases expression EXP 6480464 Aflatoxin B1 results in decreased expression of AFM mRNA CTD PMID:19770486 Afm Mouse amiodarone affects expression ISO Afm (Rattus norvegicus) 6480464 Amiodarone affects the expression of AFM mRNA CTD PMID:19483382 Afm Mouse ammonium chloride affects expression ISO Afm (Rattus norvegicus) 6480464 Ammonium Chloride affects the expression of AFM mRNA CTD PMID:16483693 Afm Mouse benzbromarone affects expression ISO Afm (Rattus norvegicus) 6480464 Benzbromarone affects the expression of AFM mRNA CTD PMID:19483382 Afm Mouse benzo[a]pyrene decreases expression EXP 6480464 Benzo(a)pyrene results in decreased expression of AFM mRNA CTD PMID:19770486 Afm Mouse benzo[a]pyrene decreases expression ISO AFM (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased expression of AFM mRNA CTD PMID:22316170 and PMID:32234424 Afm Mouse bisphenol A decreases expression ISO Afm (Rattus norvegicus) 6480464 bisphenol A results in decreased expression of AFM mRNA CTD PMID:25181051 Afm Mouse bisphenol A increases expression ISO Afm (Rattus norvegicus) 6480464 bisphenol A results in increased expression of AFM mRNA CTD PMID:32145629 Afm Mouse bisphenol A affects expression ISO Afm (Rattus norvegicus) 6480464 bisphenol A affects the expression of AFM mRNA CTD PMID:30903817 Afm Mouse buta-1,3-diene decreases expression EXP 6480464 1 and 3-butadiene results in decreased expression of AFM mRNA CTD PMID:29038090 Afm Mouse cadmium atom affects binding ISO AFM (Homo sapiens) 6480464 AFM protein binds to Cadmium CTD PMID:23896426 Afm Mouse cadmium dichloride decreases expression ISO Afm (Rattus norvegicus) 6480464 Cadmium Chloride results in decreased expression of AFM mRNA CTD PMID:33453195 Afm Mouse cisplatin increases secretion ISO Afm (Rattus norvegicus) 6480464 Cisplatin results in increased secretion of AFM protein CTD PMID:28885000 Afm Mouse cisplatin increases expression EXP 6480464 Cisplatin results in increased expression of AFM protein CTD PMID:31493026 Afm Mouse clofibrate affects expression ISO Afm (Rattus norvegicus) 6480464 Clofibrate affects the expression of AFM mRNA CTD PMID:19483382 Afm Mouse copper atom affects binding ISO AFM (Homo sapiens) 6480464 AFM protein binds to Copper CTD PMID:23896426 Afm Mouse copper(0) affects binding ISO AFM (Homo sapiens) 6480464 AFM protein binds to Copper CTD PMID:23896426 Afm Mouse cyclosporin A decreases expression ISO AFM (Homo sapiens) 6480464 Cyclosporine results in decreased expression of AFM mRNA CTD PMID:20106945 and PMID:27989131 Afm Mouse cyclosporin A decreases expression EXP 6480464 Cyclosporine results in decreased expression of AFM mRNA CTD PMID:19770486 Afm Mouse doxorubicin increases secretion ISO Afm (Rattus norvegicus) 6480464 Doxorubicin results in increased secretion of AFM protein CTD PMID:28885000 Afm Mouse endosulfan decreases expression ISO AFM (Homo sapiens) 6480464 Endosulfan results in decreased expression of AFM mRNA CTD PMID:26159488 Afm Mouse endosulfan multiple interactions ISO AFM (Homo sapiens) 6480464 [Endosulfan co-treated with Tetrachlorodibenzodioxin] results in decreased expression of AFM mRNA CTD PMID:26159488 Afm Mouse flutamide decreases expression ISO Afm (Rattus norvegicus) 6480464 Flutamide results in decreased expression of AFM mRNA CTD PMID:24136188 Afm Mouse flutamide increases expression ISO Afm (Rattus norvegicus) 6480464 Flutamide results in increased expression of AFM mRNA CTD PMID:24793618 Afm Mouse fumonisin B1 decreases expression EXP 6480464 fumonisin B1 results in decreased expression of AFM mRNA CTD PMID:16221962 Afm Mouse glafenine decreases expression ISO Afm (Rattus norvegicus) 6480464 Glafenine results in decreased expression of AFM mRNA CTD PMID:24136188 Afm Mouse L-ethionine affects expression ISO Afm (Rattus norvegicus) 6480464 Ethionine affects the expression of AFM mRNA CTD PMID:19483382 Afm Mouse microcystin-LR decreases expression EXP 6480464 cyanoginosin LR results in decreased expression of AFM mRNA CTD PMID:17654400 Afm Mouse mono(2-ethylhexyl) phthalate increases expression EXP 6480464 mono-(2-ethylhexyl)phthalate results in increased expression of AFM mRNA CTD PMID:22401849 Afm Mouse N-nitrosodiethylamine increases expression EXP 6480464 Diethylnitrosamine results in increased expression of AFM mRNA CTD PMID:17942915 Afm Mouse N-nitrosodiethylamine multiple interactions ISO Afm (Rattus norvegicus) 6480464 [Diethylnitrosamine co-treated with Thioacetamide] results in decreased expression of AFM mRNA CTD PMID:28943392 Afm Mouse N-nitrosodiethylamine decreases expression ISO Afm (Rattus norvegicus) 6480464 Diethylnitrosamine results in decreased expression of AFM mRNA CTD PMID:19638242 Afm Mouse N-nitrosodiethylamine multiple interactions EXP 6480464 MET protein inhibits the reaction [Diethylnitrosamine results in increased expression of AFM mRNA] CTD PMID:17942915 Afm Mouse N-Nitrosopyrrolidine decreases expression ISO AFM (Homo sapiens) 6480464 N-Nitrosopyrrolidine results in decreased expression of AFM mRNA CTD PMID:32234424 Afm Mouse nefazodone decreases expression ISO Afm (Rattus norvegicus) 6480464 nefazodone results in decreased expression of AFM mRNA CTD PMID:24136188 Afm Mouse nimesulide decreases expression ISO Afm (Rattus norvegicus) 6480464 nimesulide results in decreased expression of AFM mRNA CTD PMID:24136188 Afm Mouse O-methyleugenol decreases expression ISO AFM (Homo sapiens) 6480464 methyleugenol results in decreased expression of AFM mRNA CTD PMID:32234424 Afm Mouse okadaic acid decreases expression ISO AFM (Homo sapiens) 6480464 Okadaic Acid results in decreased expression of AFM mRNA CTD PMID:38832940 Afm Mouse olanzapine affects phosphorylation ISO AFM (Homo sapiens) 6480464 olanzapine affects the phosphorylation of AFM protein CTD PMID:25821032 Afm Mouse omeprazole affects expression ISO Afm (Rattus norvegicus) 6480464 Omeprazole affects the expression of AFM mRNA CTD PMID:19483382 Afm Mouse paracetamol decreases expression ISO AFM (Homo sapiens) 6480464 Acetaminophen results in decreased expression of AFM mRNA CTD PMID:29067470 Afm Mouse perfluorononanoic acid decreases expression ISO AFM (Homo sapiens) 6480464 perfluoro-n-nonanoic acid results in decreased expression of AFM mRNA CTD PMID:32588087 Afm Mouse perfluorooctane-1-sulfonic acid decreases expression ISO AFM (Homo sapiens) 6480464 perfluorooctane sulfonic acid results in decreased expression of AFM mRNA CTD PMID:32588087 and PMID:36864359 Afm Mouse perfluorooctane-1-sulfonic acid multiple interactions EXP 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of AFM mRNA and [perfluorooctane sulfonic acid co-treated with Pectins] results in decreased expression of AFM mRNA CTD PMID:36331819 Afm Mouse perfluorooctanoic acid decreases expression ISO Afm (Rattus norvegicus) 6480464 perfluorooctanoic acid results in decreased expression of AFM mRNA CTD PMID:19162173 Afm Mouse pirinixic acid multiple interactions ISO AFM (Homo sapiens) 6480464 [pirinixic acid binds to and results in increased activity of PPARA protein] which results in decreased expression of AFM mRNA CTD PMID:19710929 Afm Mouse pirinixic acid decreases expression EXP 6480464 pirinixic acid results in decreased expression of AFM mRNA CTD PMID:16221962 and PMID:23811191 Afm Mouse pirinixic acid affects expression ISO Afm (Rattus norvegicus) 6480464 pirinixic acid affects the expression of AFM mRNA CTD PMID:19483382 Afm Mouse potassium dichromate decreases expression EXP 6480464 Potassium Dichromate results in decreased expression of AFM mRNA CTD PMID:23608068 Afm Mouse pregnenolone 16alpha-carbonitrile decreases expression EXP 6480464 Pregnenolone Carbonitrile results in decreased expression of AFM mRNA CTD PMID:28903501 Afm Mouse rotenone decreases expression ISO Afm (Rattus norvegicus) 6480464 Rotenone results in decreased expression of AFM mRNA CTD PMID:28374803 Afm Mouse sodium arsenite decreases expression ISO AFM (Homo sapiens) 6480464 sodium arsenite results in decreased expression of AFM mRNA CTD PMID:29301061 Afm Mouse tetrachloromethane multiple interactions ISO Afm (Rattus norvegicus) 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in decreased expression of AFM mRNA] CTD PMID:31150632 Afm Mouse tetrachloromethane decreases expression EXP 6480464 Carbon Tetrachloride results in decreased expression of AFM mRNA CTD PMID:31919559 Afm Mouse tetrachloromethane increases methylation ISO Afm (Rattus norvegicus) 6480464 Carbon Tetrachloride results in increased methylation of AFM promoter CTD PMID:30690589 Afm Mouse tetrachloromethane decreases expression ISO Afm (Rattus norvegicus) 6480464 Carbon Tetrachloride results in decreased expression of AFM mRNA CTD PMID:30690589 and PMID:31150632 Afm Mouse thioacetamide affects expression ISO Afm (Rattus norvegicus) 6480464 Thioacetamide affects the expression of AFM mRNA CTD PMID:19483382 Afm Mouse thioacetamide decreases expression ISO Afm (Rattus norvegicus) 6480464 Thioacetamide results in decreased expression of AFM mRNA CTD PMID:34492290 Afm Mouse thioacetamide multiple interactions ISO Afm (Rattus norvegicus) 6480464 [Diethylnitrosamine co-treated with Thioacetamide] results in decreased expression of AFM mRNA CTD PMID:28943392 Afm Mouse titanium dioxide increases expression EXP 6480464 titanium dioxide results in increased expression of AFM mRNA CTD PMID:35295148 Afm Mouse Triptolide increases expression ISO Afm (Rattus norvegicus) 6480464 triptolide results in increased expression of AFM protein CTD PMID:32519852 Afm Mouse Triptolide decreases expression EXP 6480464 triptolide results in decreased expression of AFM mRNA CTD PMID:32835833 Afm Mouse valproic acid decreases methylation ISO AFM (Homo sapiens) 6480464 Valproic Acid results in decreased methylation of AFM gene CTD PMID:29154799 Afm Mouse valproic acid decreases expression ISO AFM (Homo sapiens) 6480464 Valproic Acid results in decreased expression of AFM mRNA CTD PMID:29154799 Afm Mouse vancomycin increases expression EXP 6480464 Vancomycin results in increased expression of AFM mRNA CTD PMID:18930951 Afm Mouse vinclozolin increases methylation ISO Afm (Rattus norvegicus) 6480464 vinclozolin results in increased methylation of AFM gene CTD PMID:31079544
(+)-schisandrin B (ISO) (1->4)-beta-D-glucan (EXP) 1,2-dimethylhydrazine (EXP) 1-naphthyl isothiocyanate (ISO) 17beta-estradiol (EXP,ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4-dibromophenyl 2,4,5-tribromophenyl ether (EXP) 2,4-dinitrotoluene (ISO) 2,6-dinitrotoluene (ISO) 3,3',4,4',5-pentachlorobiphenyl (ISO) 4,4'-diaminodiphenylmethane (EXP,ISO) 4,4'-sulfonyldiphenol (EXP) 5-methoxy-2-\{[(4-methoxy-3,5-dimethylpyridin-2-yl)methyl]sulfinyl\}-1H-benzimidazole (ISO) 6-propyl-2-thiouracil (ISO) aflatoxin B1 (EXP,ISO) amiodarone (ISO) ammonium chloride (ISO) benzbromarone (ISO) benzo[a]pyrene (EXP,ISO) bisphenol A (ISO) buta-1,3-diene (EXP) cadmium atom (ISO) cadmium dichloride (ISO) cisplatin (EXP,ISO) clofibrate (ISO) copper atom (ISO) copper(0) (ISO) cyclosporin A (EXP,ISO) doxorubicin (ISO) endosulfan (ISO) flutamide (ISO) fumonisin B1 (EXP) glafenine (ISO) L-ethionine (ISO) microcystin-LR (EXP) mono(2-ethylhexyl) phthalate (EXP) N-nitrosodiethylamine (EXP,ISO) N-Nitrosopyrrolidine (ISO) nefazodone (ISO) nimesulide (ISO) O-methyleugenol (ISO) okadaic acid (ISO) olanzapine (ISO) omeprazole (ISO) paracetamol (ISO) perfluorononanoic acid (ISO) perfluorooctane-1-sulfonic acid (EXP,ISO) perfluorooctanoic acid (ISO) pirinixic acid (EXP,ISO) potassium dichromate (EXP) pregnenolone 16alpha-carbonitrile (EXP) rotenone (ISO) sodium arsenite (ISO) tetrachloromethane (EXP,ISO) thioacetamide (ISO) titanium dioxide (EXP) Triptolide (EXP,ISO) valproic acid (ISO) vancomycin (EXP) vinclozolin (ISO)
Afm Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 5 90,666,808 - 90,701,403 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 5 90,666,791 - 90,701,402 (+) Ensembl GRCm39 Ensembl GRCm38 5 90,518,949 - 90,553,544 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 5 90,518,932 - 90,553,543 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 5 90,947,975 - 90,982,570 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 5 91,594,163 - 91,641,425 (+) NCBI MGSCv36 mm8 Celera 5 88,680,306 - 88,704,975 (+) NCBI Celera Cytogenetic Map 5 E1 NCBI cM Map 5 44.78 NCBI
AFM Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 4 73,481,745 - 73,504,001 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 4 73,481,745 - 73,504,001 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 4 74,347,462 - 74,369,718 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 4 74,566,326 - 74,588,582 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 4 74,712,496 - 74,734,753 NCBI Celera 4 71,707,194 - 71,729,436 (+) NCBI Celera Cytogenetic Map 4 q13.3 NCBI HuRef 4 70,158,855 - 70,181,099 (+) NCBI HuRef CHM1_1 4 74,383,462 - 74,405,708 (+) NCBI CHM1_1 T2T-CHM13v2.0 4 76,825,372 - 76,847,610 (+) NCBI T2T-CHM13v2.0
Afm Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 14 17,815,194 - 17,848,042 (-) NCBI GRCr8 mRatBN7.2 14 17,531,022 - 17,563,868 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 14 17,531,024 - 17,563,870 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 14 17,525,337 - 17,550,140 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 14 18,844,268 - 18,869,067 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 14 17,536,413 - 17,568,193 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 14 19,078,678 - 19,132,212 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 14 19,078,680 - 19,132,208 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 14 19,035,336 - 19,039,510 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 Rnor_5.0 14 18,988,809 - 19,008,149 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 14 19,049,664 - 19,082,977 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 14 19,049,663 - 19,082,977 (-) NCBI Celera 14 16,899,392 - 16,930,240 (-) NCBI Celera Cytogenetic Map 14 p22 NCBI
AFM Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 3 56,559,516 - 56,583,201 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 4 56,748,574 - 56,771,840 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 4 50,691,556 - 50,714,140 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 4 56,523,712 - 56,545,919 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 4 56,519,389 - 56,545,974 (-) Ensembl panpan1.1 panPan2
AFM Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 13 62,212,230 - 62,235,136 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 13 62,053,814 - 62,294,709 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 13 61,881,887 - 61,904,769 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 13 63,021,767 - 63,044,655 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 13 63,021,855 - 63,044,642 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 13 62,633,366 - 62,656,263 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 13 62,126,432 - 62,149,372 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 13 63,262,556 - 63,285,453 (+) NCBI UU_Cfam_GSD_1.0
AFM Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 8 69,706,896 - 69,728,255 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 8 69,706,823 - 69,728,269 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 8 73,806,942 - 73,828,360 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
AFM Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 7 21,950,222 - 21,972,612 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 7 21,950,705 - 21,972,739 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666084 824,453 - 846,386 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Afm
.
Predicted Target Of
Count of predictions: 403 Count of miRNA genes: 334 Interacting mature miRNAs: 360 Transcripts: ENSMUST00000113179, ENSMUST00000128740 Prediction methods: Miranda, Rnahybrid Result types: miRGate_prediction
4140990 Lgq6_m late growth QTL 6 (mouse) Not determined 32133234 100777931 Mouse 1301010 ahl2_m age related hearing loss 2 (mouse) Not determined 5 62650568 96650688 Mouse 1301399 Cpfd3_m cerebellum pattern fissures (mouse) Not determined 5 87386871 121387065 Mouse 12910784 Pwgrq15_m post-weaning growth rate QTL 15 (mouse) 5 77175823 97658215 Mouse 1301524 Lmb2_m lupus in MRL and B6 F2 cross (mouse) Not determined 5 37581488 112465722 Mouse 25314315 Mlh1fc4_m MLH1 foci count 4 (mouse) 5 74460661 132528839 Mouse 1357725 Eae39_m experimental allergic encephalomyelitis 39 (mouse) Not determined 5 89418876 118864028 Mouse 10045972 Tir5_m trypanosome infection response 5 (mouse) Not determined 5 63705442 104387065 Mouse 1300993 Hycdc_m hypercapnic duty cycle (mouse) Not determined 5 90561006 124561151 Mouse 1301126 Bwem1_m body weight day 30 males 1 (mouse) Not determined 5 87386871 121387065 Mouse 4141219 W10q16_m weight 10 weeks QTL 16 (mouse) Not determined 32133234 100777931 Mouse 12910816 Ogrq2_m overall growth rate QTL 2 (mouse) 5 77175823 97658215 Mouse 1301691 Cdcs10_m cytokine deficiency colitis susceptibility 10 (mouse) Not determined 5 76280786 110280917 Mouse 11041665 Lmr24_m leishmaniasis resistance 24 (mouse) 5 52694462 107321041 Mouse 10043958 Chldq12_m cholesterol and HDL QTL 12 (mouse) Not determined 5 87386871 121387065 Mouse 26884395 Humsd2_m humerus midshaft diameter 2, 10 week (mouse) 5 70057343 132528839 Mouse 11252124 Modvl6_m modifier of vacuolated lens 6 (mouse) 5 62650568 96650688 Mouse 1301419 Cypr3_m cytokine production 3 (mouse) Not determined 5 81019649 115019803 Mouse 11341716 Rvfs3_m Rift Valley fever susceptibility 3 (mouse) 5 26441234 138455402 Mouse 13506928 Recrq8_m recombination rate in male meiosis QTL 8 (mouse) 5 74460661 132528839 Mouse 1301843 Listr1_m listeriosis resistance 1 (mouse) Not determined 5 60246081 94246203 Mouse 10043993 Hbnr10_m Heligmosomoides bakeri nematode resistance 10 (mouse) Not determined 5 72418876 106419011 Mouse 27226719 Tibw6_m tibia width 6, proximal, 16 week (mouse) 5 72857343 139985755 Mouse 10401246 Bglu13_m blood glucose level 13 (mouse) Not determined 5 79539640 113539786 Mouse 4141438 Skmw13_m skeletal muscle weight 13 (mouse) Not determined 5 76190263 110190479 Mouse 1301713 Dbsty2_m diabesity 2 (mouse) Not determined 5 76445064 110445225 Mouse 1301457 Cfsw2_m cystic fibrosis survival to weaning 2 (mouse) Not determined 5 90561006 124561151 Mouse 11041899 Lmr24a_m leishmaniasis resistance 24a (mouse) 5 52694462 107321041 Mouse 10401245 Bglu18_m blood glucose level 18 (mouse) Not determined 5 82838468 116838597 Mouse 4142064 Tmc1m4_m Tmc1 modifier 4 (mouse) Not determined 5 54500177 127001072 Mouse 1300931 Cocrb6_m cocaine related behavior 6 (mouse) Not determined 5 76445064 110445225 Mouse 4142317 Rgcs1_m retinal ganglion cell susceptible 1 (mouse) Not determined 55388334 108762627 Mouse 1300801 Drb2_m dopamine receptor binding 2 (mouse) Not determined 5 87386871 121387065 Mouse 1301829 Thyls2_m thymic lymphoma susceptibility 2 (mouse) Not determined 5 76445064 110445225 Mouse 12904740 M1fscn2_m modifier 1 of Fscn2 (mouse) 5 66529661 100529661 Mouse 10755524 Mono1_m monocyte differential 1 (mouse) 5 80849259 114849259 Mouse 1301362 Prnr1_m prion resistance 1 (mouse) Not determined 5 89418876 146787935 Mouse 4142428 Modvl1_m modifier of vacuolated lens 1 (mouse) Not determined 62650568 96650688 Mouse 1357431 Cia27_m collagen induced arthritis 27 (mouse) Not determined 5 75315348 120018629 Mouse 11040589 Lmr3a_m leishmaniasis resistance 3a (mouse) 5 59602801 93602980 Mouse 11040590 Lmr3b_m leishmaniasis resistance 3b (mouse) 5 59602801 93602980 Mouse 11040591 Lmr3c_m leishmaniasis resistance 3c (mouse) 5 59602801 93602980 Mouse 12904739 M2fscn2_m modifier 2 of FSCN2 (mouse) 5 66529661 100529661 Mouse 1301243 Bmd2_m bone mineral density 2 (mouse) Not determined 5 55388334 100455525 Mouse 1300986 Hdlq2_m HDL QTL 2 (mouse) Not determined 5 76280786 110280917 Mouse 11049560 Lmr24d_m leishmaniasis resistance 24d (mouse) 5 64374877 98374996 Mouse 11049562 Lmr24f_m leishmaniasis resistance 24f (mouse) 5 90320962 124321041 Mouse 13464249 Ahl16_m age related hearing loss, early onset 16 (mouse) 5 76445064 110445225 Mouse 13464250 Ahl15_m age related hearing loss, early onset 15 (mouse) 5 62650568 96650688 Mouse 11040592 Lmr3d_m leishmaniasis resistance 3d (mouse) 5 59602801 93602980 Mouse 13464247 Ahl14_m age related hearing loss, early onset 14 (mouse) 5 60403062 94403160 Mouse 4141124 Dshv2_m dorsal hippocampal volume 2 (mouse) Not determined 5 75315348 98019803 Mouse 1300968 Skts4_m skin tumor susceptibility 4 (mouse) Not determined 5 89418876 124238239 Mouse 10044005 Ahl7_m age related hearing loss 7 (mouse) Not determined 5 58330502 92330641 Mouse 13464241 Ahl18_m age related hearing loss, early onset 18 (mouse) 5 87386871 121387065 Mouse 4141505 Chlq14_m circulating hormone level QTL 14 (mouse) Not determined 5 76280786 110280917 Mouse 13464242 Ahl17_m age related hearing loss, early onset 17 (mouse) 5 82838468 116838597 Mouse
Afm
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 5 90,548,828 - 90,550,274 UniSTS GRCm38 MGSCv37 5 90,977,854 - 90,979,300 UniSTS GRCm37 Celera 5 88,700,256 - 88,701,702 UniSTS Cytogenetic Map 5 E1 UniSTS cM Map 5 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000113179 ⟹ ENSMUSP00000108804
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 5 90,666,791 - 90,701,402 (+) Ensembl GRCm38.p6 Ensembl 5 90,518,932 - 90,553,543 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000128740 ⟹ ENSMUSP00000117180
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 5 90,666,808 - 90,696,916 (+) Ensembl GRCm38.p6 Ensembl 5 90,518,949 - 90,549,057 (+) Ensembl
RefSeq Acc Id:
NM_145146 ⟹ NP_660128
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 5 90,666,808 - 90,701,403 (+) NCBI GRCm38 5 90,518,949 - 90,553,544 (+) ENTREZGENE MGSCv37 5 90,947,975 - 90,982,570 (+) RGD Celera 5 88,680,306 - 88,704,975 (+) RGD cM Map 5 ENTREZGENE
Sequence:
ACATTGCTCCTTTAAATGCATGACCTTTTTCTAAAATTCAAACATGAGACACTTAAAACTTACAGGTTTTATTTTTTTCCTGTTGCCTTTGACTGAATCCCTAGCCCTACCCACAAAGCCTCAGGACG
hide sequence
RefSeq Acc Id:
NP_660128 ⟸ NM_145146
- Peptide Label:
precursor
- UniProtKB:
Q497E6 (UniProtKB/Swiss-Prot), Q3UNV0 (UniProtKB/Swiss-Prot), Q8R0J9 (UniProtKB/Swiss-Prot), O89020 (UniProtKB/Swiss-Prot)
- Sequence:
MRHLKLTGFIFFLLPLTESLALPTKPQDVDHFNATQKFIDENTTYLAIIAFSQYVQEASFDEVETLVKVMLDYRDRCWADNTLPECSKTANDAIQDMLCDMEGLPQKHNFSHCCGKAGFPRRLCFFYN
hide sequence
Ensembl Acc Id:
ENSMUSP00000108804 ⟸ ENSMUST00000113179
Ensembl Acc Id:
ENSMUSP00000117180 ⟸ ENSMUST00000128740
RGD ID: 6887114 Promoter ID: EPDNEW_M7008 Type: single initiation site Name: Afm_1 Description: Mus musculus afamin , mRNA. SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Mouse Assembly Chr Position (strand) Source GRCm38 5 90,518,949 - 90,519,009 EPDNEW
RGD ID: 6837007 Promoter ID: MM_KWN:42839 Type: Non-CpG SO ACC ID: SO:0000170 Source: MPROMDB Tissues & Cell Lines: Kidney, Liver Transcripts: OTTMUST00000083498, OTTMUST00000083555 Position: Mouse Assembly Chr Position (strand) Source MGSCv36 5 90,947,706 - 90,948,206 (+) MPROMDB
