Pink1<sup>em1Sage</sup> (PTEN induced putative kinase 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs)

Advanced Search (OLGA)

Gene: Pink1^em1Sage (PTEN induced putative kinase 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs) Rattus norvegicus

Analyze

Symbol:

Pink1^em1Sage

Name:

PTEN induced putative kinase 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs

RGD ID:

7241046

Description:

This allele was made by ZFN mutagenesis. The resulting mutation is a 26-bp frameshift deletion in exon 4 (ACTACTACCCAGAAGGCCTGGGCCAC)
ASSOCIATED WITH abnormal gait; abnormal motor coordination/balance; abnormal muscle tone; ASSOCIATED WITH Parkinson's disease

Type:

allele of Pink1

Previously known as:

Pink1^[em1Sage]; Pink1em1Sage

Is Marker For:

Strains: LE-Pink1^em1Sage-/- LE-Pink1^em1Sage

Latest Assembly:

mRatBN7.2 - mRatBN7.2 Assembly

Position:

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Cytogenetic Map	5		RGD

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

Parkinson's disease (IMP)

Phenotype Annotations Click to see Annotation Detail View

Mammalian Phenotype

abnormal gait (IMP)

abnormal motor coordination/balance (IMP)

abnormal muscle tone (IMP)

decreased brain tyrosine 3-monooxygenase activity (IMP)

decreased grip strength (IMP)

decreased locomotor activity (IMP)

decreased substantia nigra cell number (IMP)

decreased substantia nigra size (IMP)

decreased vertical activity (IMP)

increased body weight (IMP)

increased dopamine level (IMP)

increased oxygen consumption (IMP)

increased serotonin level (IMP)

loss of dopaminergic neurons (IMP)

References

References - curated

#	Reference Title	Reference Citation
1.	Phenotypic characterization of recessive gene knockout rat models of Parkinson's disease.	Dave KD, etal., Neurobiol Dis. 2014 Oct;70:190-203. doi: 10.1016/j.nbd.2014.06.009. Epub 2014 Jun 24.
2.	Data registered by Sigma Advanced Genetic Engineering Labs	Personal communication with SAGE Labs and RGD curators
3.	Regulation of dopamine presynaptic markers and receptors in the striatum of DJ-1 and Pink1 knockout rats.	Sun J, etal., Neurosci Lett. 2013 Dec 17;557 Pt B:123-8. doi: 10.1016/j.neulet.2013.10.034. Epub 2013 Oct 22.
4.	Early Expression of Parkinson's Disease-Related Mitochondrial Abnormalities in PINK1 Knockout Rats.	Villeneuve LM, etal., Mol Neurobiol. 2016 Jan;53(1):171-86. doi: 10.1007/s12035-014-8927-y. Epub 2014 Nov 25.

Genomics

Related Rat Strains

The following Strains have been annotated to Pink1^em1Sage

LE-Pink1^em1Sage-/- LE-Pink1^em1Sage

Expression

Sequence

Nucleotide Sequences


RefSeq Transcripts	NM_001106694	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Additional Information

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message

Mammalian Phenotype