Pink1<sup>em1Sage</sup> (PTEN induced putative kinase 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: Pink1em1Sage (PTEN induced putative kinase 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs) Rattus norvegicus
Analyze
Symbol: Pink1em1Sage
Name: PTEN induced putative kinase 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs
RGD ID: 7241046
Description: This allele was made by ZFN mutagenesis. The resulting mutation is a 26-bp frameshift deletion in exon 4 (ACTACTACCCAGAAGGCCTGGGCCAC)
ASSOCIATED WITH abnormal gait; abnormal motor coordination/balance; abnormal muscle tone; ASSOCIATED WITH Parkinson's disease
Type: allele  of Pink1  
Also known as: Pink1em1Sage
Is Marker For: Strains:   LE-Pink1em1Sage-/-   LE-Pink1em1Sage  
Latest Assembly: mRatBN7.2 - mRatBN7.2 Assembly
Position:
Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
Cytogenetic Map5 RGD


References


Genomics


Related Rat Strains
The following Strains have been annotated to Pink1em1Sage


Expression


Sequence

Nucleotide Sequences
RefSeq Transcripts NM_001106694 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information