Pink1<sup>em1Sage</sup> (PTEN induced putative kinase 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: Pink1em1Sage (PTEN induced putative kinase 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs) Rattus norvegicus
Analyze
Symbol: Pink1em1Sage
Name: PTEN induced putative kinase 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs
RGD ID: 7241046
Description: This allele was made by ZFN mutagenesis. The resulting mutation is a 26-bp frameshift deletion in exon 4 (ACTACTACCCAGAAGGCCTGGGCCAC)
ASSOCIATED WITH abnormal gait; abnormal motor coordination/balance; abnormal muscle tone; ASSOCIATED WITH Parkinson's disease
Type: allele  of Pink1  
Previously known as: Pink1em1Sage
Is Marker For: Strains:   LE-Pink1em1Sage-/-   LE-Pink1em1Sage  
Latest Assembly: mRatBN7.2 - mRatBN7.2 Assembly
Position:
Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
Cytogenetic Map5 RGD


References

References - curated
# Reference Title Reference Citation
1. Phenotypic characterization of recessive gene knockout rat models of Parkinson's disease. Dave KD, etal., Neurobiol Dis. 2014 Oct;70:190-203. doi: 10.1016/j.nbd.2014.06.009. Epub 2014 Jun 24.
2. Data registered by Sigma Advanced Genetic Engineering Labs Personal communication with SAGE Labs and RGD curators
3. Regulation of dopamine presynaptic markers and receptors in the striatum of DJ-1 and Pink1 knockout rats. Sun J, etal., Neurosci Lett. 2013 Dec 17;557 Pt B:123-8. doi: 10.1016/j.neulet.2013.10.034. Epub 2013 Oct 22.
4. Early Expression of Parkinson's Disease-Related Mitochondrial Abnormalities in PINK1 Knockout Rats. Villeneuve LM, etal., Mol Neurobiol. 2016 Jan;53(1):171-86. doi: 10.1007/s12035-014-8927-y. Epub 2014 Nov 25.

Genomics


Related Rat Strains
The following Strains have been annotated to Pink1em1Sage


Expression


Sequence

Nucleotide Sequences
RefSeq Transcripts NM_001106694 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information