Strain: LE-Pink1em1Sage-/-

Symbol: LE-Pink1em1Sage-/-
Strain: LE-Pink1em1-/-
Substrain: Sage
Ontology ID: RS:0003389
Alleles: Pink1em1Sage
Also known as: LE-Pink1em1Sage-/-; ;LE-Pink1em1Sage-/Pink1em1Sage-; LEH- Pink1 tm1sage; Pink1 (Park6) Knockout Rat ; TGRL4690
Type: mutant
Source: Horizon Discovery
Origin: ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offspring which were intercrossed and offspring maintained as homozygous. This allele was made by ZFN mutagenesis. The resulting mutation is a 26-bp frameshift deletion in exon 4 (ACTACTACCCAGAAGGCCTGGGCCAC).
Genetic Status: Homozygous
Last Known Status: Live Animals (as of 2017-05-08)
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.05156,677,146 - 156,689,258RGD_MAPPER_PIPELINERnor6.0
Rnor_5.05160,425,715 - 160,437,827RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.45157,091,181 - 157,103,293RGD_MAPPER_PIPELINERGSC3.4

Disease Annotations
Phenotype Annotations
Experimental Data Annotations
References - curated
RGD Disease Portals

Additional Information

Nomenclature History
More on this Strain
Strain Nomenclature
Strain Registration

RGD Object Information
RGD ID: 7241049
Created: 2013-02-25
Species: Rattus norvegicus
Last Modified: 2016-04-27
Status: ACTIVE