Advanced Search (OLGA)

Gene: MTOR-AS1 (MTOR antisense RNA 1) Homo sapiens

Subscribe to Updates

Analyze

Symbol:

MTOR-AS1

Name:

MTOR antisense RNA 1

RGD ID:

6481400

HGNC Page

HGNC:40242

Description:

ASSOCIATED WITH Focal Cortical Dysplasia of Taylor; genetic disease; Smith-Kingsmore Syndrome; INTERACTS WITH 2-hydroxypropanoic acid; rac-lactic acid

Type:

ncrna (Ensembl: lncRNA)

RefSeq Status:

VALIDATED

Previously known as:

RP11-99P18.1

Allele / Splice:

See ClinVar data

Latest Assembly:

GRCh38 - Human Genome Assembly GRCh38

Position:

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	1	11,143,898 - 11,149,538 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	1	11,143,898 - 11,149,537 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	1	11,203,955 - 11,209,595 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Cytogenetic Map	1	p36.22	NCBI
HuRef	1	10,355,265 - 10,360,907 (+)	NCBI		HuRef
CHM1_1	1	11,191,914 - 11,197,554 (+)	NCBI		CHM1_1
T2T-CHM13v2.0	1	10,685,476 - 10,691,116 (+)	NCBI		T2T-CHM13v2.0

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
MTOR-AS1	Human	Focal Cortical Dysplasia of Taylor		IAGP	(Homo sapiens)	8554872	ClinVar Annotator: match by term: Focal cortical dysplasia type 2	ClinVar	PMID:25741868
MTOR-AS1	Human	genetic disease		IAGP	(Homo sapiens) and (Homo sapiens)	8554872	ClinVar Annotator: match by term: Inborn genetic diseases	ClinVar	PMID:28492532
MTOR-AS1	Human	Smith-Kingsmore Syndrome		IAGP	(Homo sapiens) more ...	8554872	ClinVar more ...	ClinVar	PMID:28492532
MTOR-AS1	Human	Smith-Kingsmore Syndrome		IAGP	(Homo sapiens) and (Homo sapiens)	8554872	ClinVar more ...	ClinVar	PMID:25741868 and PMID:28492532
MTOR-AS1	Human	Smith-Kingsmore Syndrome		IAGP	(Homo sapiens) and (Homo sapiens)	8554872	ClinVar Annotator: match by term: Macrocephaly-intellectual disability-neurodevelopmental disorder-small thorax syndrome	ClinVar

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
MTOR-AS1	Human	2-hydroxypropanoic acid	increases expression	EXP		6480464	Lactic Acid results in increased expression of MTOR-AS1 mRNA	CTD	PMID:30851411
MTOR-AS1	Human	rac-lactic acid	increases expression	EXP		6480464	Lactic Acid results in increased expression of MTOR-AS1 mRNA	CTD	PMID:30851411

#	Reference Title	Reference Citation
1.	ClinVar Automated Import and Annotation Pipeline	RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations

PMID:11329013

Variants in MTOR-AS1
101 total Variants

Name	Type	Condition(s)	Position(s)	Clinical significance
NM_004958.4(MTOR):c.4791C>T (p.Ser1597=)	single nucleotide variant	not provided [RCV002119267]	Chr1:11144729 [GRCh38] Chr1:11204786 [GRCh37] Chr1:11127373 [NCBI36] Chr1:1p36.22	likely benign\|not provided
GRCh38/hg38 1p36.23-36.21(chr1:9064492-12666744)x1	copy number loss	See cases [RCV000133779]	Chr1:9064492..12666744 [GRCh38] Chr1:9124551..12726755 [GRCh37] Chr1:9047138..12649342 [NCBI36] Chr1:1p36.23-36.21	pathogenic
GRCh38/hg38 1p36.23-36.22(chr1:8283694-12470133)x1	copy number loss	See cases [RCV000135807]	Chr1:8283694..12470133 [GRCh38] Chr1:8343754..12530188 [GRCh37] Chr1:8266341..12452775 [NCBI36] Chr1:1p36.23-36.22	pathogenic
GRCh38/hg38 1p36.33-36.22(chr1:844347-12470133)x1	copy number loss	See cases [RCV000136695]	Chr1:844347..12470133 [GRCh38] Chr1:779727..12530188 [GRCh37] Chr1:769590..12452775 [NCBI36] Chr1:1p36.33-36.22	pathogenic\|likely pathogenic
GRCh38/hg38 1p36.32-36.21(chr1:4898439-12911913)x1	copy number loss	See cases [RCV000137461]	Chr1:4898439..12911913 [GRCh38] Chr1:4958499..12971757 [GRCh37] Chr1:4858359..12894344 [NCBI36] Chr1:1p36.32-36.21	pathogenic
GRCh38/hg38 1p36.31-36.21(chr1:6303641-15799093)x1	copy number loss	See cases [RCV000137948]	Chr1:6303641..15799093 [GRCh38] Chr1:6363701..16125588 [GRCh37] Chr1:6286288..15998175 [NCBI36] Chr1:1p36.31-36.21	pathogenic\|likely benign
GRCh38/hg38 1p36.22-36.21(chr1:9428538-15815791)x1	copy number loss	See cases [RCV000140873]	Chr1:9428538..15815791 [GRCh38] Chr1:9488597..16142286 [GRCh37] Chr1:9411184..16014873 [NCBI36] Chr1:1p36.22-36.21	pathogenic
GRCh38/hg38 1p36.22-36.21(chr1:11021751-15236671)x3	copy number gain	See cases [RCV000141823]	Chr1:11021751..15236671 [GRCh38] Chr1:11081808..15563167 [GRCh37] Chr1:11004395..15435754 [NCBI36] Chr1:1p36.22-36.21	likely pathogenic
GRCh38/hg38 1p36.22-36.21(chr1:10264397-15780840)x1	copy number loss	See cases [RCV000141438]	Chr1:10264397..15780840 [GRCh38] Chr1:10324455..16107335 [GRCh37] Chr1:10247042..15979922 [NCBI36] Chr1:1p36.22-36.21	pathogenic
GRCh38/hg38 1p36.31-36.13(chr1:6554885-16056011)x3	copy number gain	See cases [RCV000142906]	Chr1:6554885..16056011 [GRCh38] Chr1:6614945..16382506 [GRCh37] Chr1:6537532..16255093 [NCBI36] Chr1:1p36.31-36.13	pathogenic
GRCh38/hg38 1p36.31-36.13(chr1:5363826-18360302)x1	copy number loss	See cases [RCV000142771]	Chr1:5363826..18360302 [GRCh38] Chr1:5423886..18686796 [GRCh37] Chr1:5323746..18559383 [NCBI36] Chr1:1p36.31-36.13	pathogenic
GRCh38/hg38 1p36.31-36.21(chr1:6652339-12724844)x3	copy number gain	See cases [RCV000051794]	Chr1:6652339..12724844 [GRCh38] Chr1:6712399..12784811 [GRCh37] Chr1:6634986..12707398 [NCBI36] Chr1:1p36.31-36.21	pathogenic
GRCh38/hg38 1p36.31-36.13(chr1:6853513-17326813)x3	copy number gain	Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000051795]\|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000051795]\|See cases [RCV000051795]	Chr1:6853513..17326813 [GRCh38] Chr1:6913573..17685411 [GRCh37] Chr1:6836160..17557998 [NCBI36] Chr1:1p36.31-36.13	pathogenic
GRCh38/hg38 1p36.22(chr1:10637036-11293430)x3	copy number gain	See cases [RCV000051459]	Chr1:10637036..11293430 [GRCh38] Chr1:10697093..11353487 [GRCh37] Chr1:10619680..11276074 [NCBI36] Chr1:1p36.22	uncertain significance
GRCh38/hg38 1p36.23-36.21(chr1:7165036-13111056)x1	copy number loss	See cases [RCV000053755]	Chr1:7165036..13111056 [GRCh38] Chr1:7225096..13178528 [GRCh37] Chr1:7147683..13101115 [NCBI36] Chr1:1p36.23-36.21	pathogenic
GRCh38/hg38 1p36.23-36.13(chr1:9034671-16441465)x1	copy number loss	See cases [RCV000053756]	Chr1:9034671..16441465 [GRCh38] Chr1:9094730..16767960 [GRCh37] Chr1:9017317..16640547 [NCBI36] Chr1:1p36.23-36.13	pathogenic
GRCh38/hg38 1p36.22-36.21(chr1:9406722-12852772)x1	copy number loss	Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053757]\|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053757]\|See cases [RCV000053757]	Chr1:9406722..12852772 [GRCh38] Chr1:9466781..12912625 [GRCh37] Chr1:9389368..12835212 [NCBI36] Chr1:1p36.22-36.21	pathogenic
GRCh38/hg38 1p36.32-36.21(chr1:2963330-12666744)x1	copy number loss	Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053713]\|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053713]\|See cases [RCV000053713]	Chr1:2963330..12666744 [GRCh38] Chr1:2879895..12726755 [GRCh37] Chr1:2869755..12649342 [NCBI36] Chr1:1p36.32-36.21	pathogenic
GRCh38/hg38 1p36.32-36.13(chr1:3006193-17688934)x1	copy number loss	See cases [RCV000053714]	Chr1:3006193..17688934 [GRCh38] Chr1:2922757..18015429 [GRCh37] Chr1:2912617..17888016 [NCBI36] Chr1:1p36.32-36.13	pathogenic
GRCh38/hg38 1p36.32-36.22(chr1:3319336-11243395)x1	copy number loss	Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053716]\|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053716]\|See cases [RCV000053716]	Chr1:3319336..11243395 [GRCh38] Chr1:3235900..11303452 [GRCh37] Chr1:3225760..11226039 [NCBI36] Chr1:1p36.32-36.22	pathogenic
GRCh38/hg38 1p36.32-36.21(chr1:4898439-13111056)x1	copy number loss	See cases [RCV000053724]	Chr1:4898439..13111056 [GRCh38] Chr1:4958499..13178528 [GRCh37] Chr1:4858359..13101115 [NCBI36] Chr1:1p36.32-36.21	pathogenic
GRCh38/hg38 1p36.22(chr1:10203955-12060262)x1	copy number loss	See cases [RCV000053758]	Chr1:10203955..12060262 [GRCh38] Chr1:10264013..12120319 [GRCh37] Chr1:10186600..12042906 [NCBI36] Chr1:1p36.22	pathogenic
GRCh38/hg38 1p36.22-36.12(chr1:10556797-22557907)x1	copy number loss	See cases [RCV000053760]	Chr1:10556797..22557907 [GRCh38] Chr1:10616854..22884400 [GRCh37] Chr1:10539441..22756987 [NCBI36] Chr1:1p36.22-36.12	pathogenic
GRCh38/hg38 1p36.22-36.13(chr1:10621776-16520709)x1	copy number loss	See cases [RCV000053763]	Chr1:10621776..16520709 [GRCh38] Chr1:10681833..16847204 [GRCh37] Chr1:10604420..16719791 [NCBI36] Chr1:1p36.22-36.13	pathogenic
GRCh38/hg38 1p36.22-36.13(chr1:10809039-16422500)x1	copy number loss	See cases [RCV000053765]	Chr1:10809039..16422500 [GRCh38] Chr1:10869096..16748995 [GRCh37] Chr1:10791683..16621582 [NCBI36] Chr1:1p36.22-36.13	pathogenic
GRCh38/hg38 1p36.22-36.13(chr1:11121625-16324498)x1	copy number loss	See cases [RCV000053766]	Chr1:11121625..16324498 [GRCh38] Chr1:11181682..16650993 [GRCh37] Chr1:11104269..16523580 [NCBI36] Chr1:1p36.22-36.13	pathogenic
NM_004958.4(MTOR):c.4606A>G (p.Ile1536Val)	single nucleotide variant	Macrocephaly-intellectual disability-neurodevelopmental disorder-small thorax syndrome [RCV000258926]	Chr1:11146756 [GRCh38] Chr1:11206813 [GRCh37] Chr1:1p36.22	uncertain significance
NM_004958.4(MTOR):c.4785G>A (p.Met1595Ile)	single nucleotide variant	Macrocephaly-intellectual disability-neurodevelopmental disorder-small thorax syndrome [RCV000209880]	Chr1:11144735 [GRCh38] Chr1:11204792 [GRCh37] Chr1:1p36.22	pathogenic
NM_004958.4(MTOR):c.4731G>A (p.Ala1577=)	single nucleotide variant	Macrocephaly-intellectual disability-neurodevelopmental disorder-small thorax syndrome [RCV001775919]\|not provided [RCV001523548]\|not specified [RCV000602357]	Chr1:11145001 [GRCh38] Chr1:11205058 [GRCh37] Chr1:1p36.22	benign
NM_004958.4(MTOR):c.4597A>G (p.Thr1533Ala)	single nucleotide variant	Macrocephaly-intellectual disability-neurodevelopmental disorder-small thorax syndrome [RCV001593225]\|not provided [RCV001055775]	Chr1:11146765 [GRCh38] Chr1:11206822 [GRCh37] Chr1:1p36.22	uncertain significance
NM_004958.4(MTOR):c.4687-13G>T	single nucleotide variant	not provided [RCV001708056]	Chr1:11145058 [GRCh38] Chr1:11205115 [GRCh37] Chr1:1p36.22	benign
NM_004958.4(MTOR):c.4867C>T (p.Leu1623=)	single nucleotide variant	not provided [RCV000904214]	Chr1:11144653 [GRCh38] Chr1:11204710 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4608C>A (p.Ile1536=)	single nucleotide variant	not provided [RCV000868498]	Chr1:11146754 [GRCh38] Chr1:11206811 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4623T>A (p.His1541Gln)	single nucleotide variant	not provided [RCV001061959]	Chr1:11146739 [GRCh38] Chr1:11206796 [GRCh37] Chr1:1p36.22	benign\|uncertain significance
NM_004958.4(MTOR):c.4687-12dup	duplication	MTOR-related disorder [RCV003955630]\|not provided [RCV000865450]	Chr1:11145054..11145055 [GRCh38] Chr1:11205111..11205112 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4828G>A (p.Glu1610Lys)	single nucleotide variant	not provided [RCV000817604]	Chr1:11144692 [GRCh38] Chr1:11204749 [GRCh37] Chr1:1p36.22	likely benign\|uncertain significance
NM_004958.4(MTOR):c.4841T>C (p.Ile1614Thr)	single nucleotide variant	Inborn genetic diseases [RCV002537024]\|MTOR-related disorder [RCV003955510]\|not provided [RCV000796358]	Chr1:11144679 [GRCh38] Chr1:11204736 [GRCh37] Chr1:1p36.22	benign\|likely benign\|uncertain significance
NM_004958.4(MTOR):c.4571-10G>A	single nucleotide variant	not provided [RCV000823808]	Chr1:11146801 [GRCh38] Chr1:11206858 [GRCh37] Chr1:1p36.22	benign\|uncertain significance
NM_004958.4(MTOR):c.4770G>A (p.Met1590Ile)	single nucleotide variant	not provided [RCV000798068]	Chr1:11144750 [GRCh38] Chr1:11204807 [GRCh37] Chr1:1p36.22	likely benign\|conflicting interpretations of pathogenicity\|uncertain significance
NM_004958.4(MTOR):c.4612C>T (p.Arg1538Trp)	single nucleotide variant	not provided [RCV001208157]	Chr1:11146750 [GRCh38] Chr1:11206807 [GRCh37] Chr1:1p36.22	likely benign\|conflicting interpretations of pathogenicity\|uncertain significance
NM_004958.4(MTOR):c.4687-187T>C	single nucleotide variant	not provided [RCV001555735]	Chr1:11145232 [GRCh38] Chr1:11205289 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4686+254G>C	single nucleotide variant	not provided [RCV001671887]	Chr1:11146422 [GRCh38] Chr1:11206479 [GRCh37] Chr1:1p36.22	benign
NM_004958.4(MTOR):c.4686+189G>A	single nucleotide variant	not provided [RCV001594110]	Chr1:11146487 [GRCh38] Chr1:11206544 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4629G>A (p.Gly1543=)	single nucleotide variant	not provided [RCV000932717]	Chr1:11146733 [GRCh38] Chr1:11206790 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4795C>T (p.Leu1599=)	single nucleotide variant	not provided [RCV000945897]	Chr1:11144725 [GRCh38] Chr1:11204782 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4649T>G (p.Leu1550Arg)	single nucleotide variant	Inborn genetic diseases [RCV002562574]\|not provided [RCV001223015]	Chr1:11146713 [GRCh38] Chr1:11206770 [GRCh37] Chr1:1p36.22	benign\|uncertain significance
NM_004958.4(MTOR):c.4846C>T (p.Arg1616Cys)	single nucleotide variant	not provided [RCV001551982]	Chr1:11144674 [GRCh38] Chr1:11204731 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4571-304G>T	single nucleotide variant	not provided [RCV001553182]	Chr1:11147095 [GRCh38] Chr1:11207152 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4686+110C>T	single nucleotide variant	not provided [RCV001636201]	Chr1:11146566 [GRCh38] Chr1:11206623 [GRCh37] Chr1:1p36.22	benign
NM_004958.4(MTOR):c.4686+43T>A	single nucleotide variant	not provided [RCV001619110]	Chr1:11146633 [GRCh38] Chr1:11206690 [GRCh37] Chr1:1p36.22	benign
NM_004958.4(MTOR):c.4862A>G (p.Glu1621Gly)	single nucleotide variant	not provided [RCV001066749]	Chr1:11144658 [GRCh38] Chr1:11204715 [GRCh37] Chr1:1p36.22	benign\|uncertain significance
NM_004958.4(MTOR):c.4837G>A (p.Glu1613Lys)	single nucleotide variant	not provided [RCV001202286]	Chr1:11144683 [GRCh38] Chr1:11204740 [GRCh37] Chr1:1p36.22	benign\|uncertain significance
NM_004958.4(MTOR):c.4687-3T>C	single nucleotide variant	not provided [RCV001034209]\|not specified [RCV003396624]	Chr1:11145048 [GRCh38] Chr1:11205105 [GRCh37] Chr1:1p36.22	likely benign\|uncertain significance
NM_004958.4(MTOR):c.4591G>C (p.Glu1531Gln)	single nucleotide variant	not provided [RCV001034227]	Chr1:11146771 [GRCh38] Chr1:11206828 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4758A>G (p.Ala1586=)	single nucleotide variant	not provided [RCV001371111]	Chr1:11144974 [GRCh38] Chr1:11205031 [GRCh37] Chr1:1p36.22	likely benign\|uncertain significance
NM_004958.4(MTOR):c.4699G>T (p.Ala1567Ser)	single nucleotide variant	not provided [RCV001363633]	Chr1:11145033 [GRCh38] Chr1:11205090 [GRCh37] Chr1:1p36.22	benign\|uncertain significance
NM_004958.4(MTOR):c.4698G>A (p.Lys1566=)	single nucleotide variant	not provided [RCV001511004]	Chr1:11145034 [GRCh38] Chr1:11205091 [GRCh37] Chr1:1p36.22	benign
NM_004958.4(MTOR):c.4765-10C>A	single nucleotide variant	not provided [RCV001442026]	Chr1:11144765 [GRCh38] Chr1:11204822 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4767C>T (p.Ala1589=)	single nucleotide variant	not provided [RCV001483943]	Chr1:11144753 [GRCh38] Chr1:11204810 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4847G>A (p.Arg1616His)	single nucleotide variant	not provided [RCV001463900]\|not specified [RCV004782742]	Chr1:11144673 [GRCh38] Chr1:11204730 [GRCh37] Chr1:1p36.22	likely benign\|uncertain significance
NM_004958.4(MTOR):c.4797G>A (p.Leu1599=)	single nucleotide variant	not provided [RCV001424420]	Chr1:11144723 [GRCh38] Chr1:11204780 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4754G>A (p.Arg1585Gln)	single nucleotide variant	not provided [RCV001409985]	Chr1:11144978 [GRCh38] Chr1:11205035 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4737A>G (p.Ala1579=)	single nucleotide variant	MTOR-related disorder [RCV003973306]\|not provided [RCV001447800]	Chr1:11144995 [GRCh38] Chr1:11205052 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4680A>G (p.Ala1560=)	single nucleotide variant	not provided [RCV001411666]	Chr1:11146682 [GRCh38] Chr1:11206739 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4872+9G>A	single nucleotide variant	not provided [RCV001494966]	Chr1:11144639 [GRCh38] Chr1:11204696 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4692T>C (p.Ile1564=)	single nucleotide variant	not provided [RCV001452944]	Chr1:11145040 [GRCh38] Chr1:11205097 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4740A>G (p.Gly1580=)	single nucleotide variant	not provided [RCV001456004]	Chr1:11144992 [GRCh38] Chr1:11205049 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4628G>A (p.Gly1543Glu)	single nucleotide variant	not provided [RCV001767890]	Chr1:11146734 [GRCh38] Chr1:11206791 [GRCh37] Chr1:1p36.22	conflicting interpretations of pathogenicity\|uncertain significance
NM_004958.4(MTOR):c.4571-7T>A	single nucleotide variant	not provided [RCV001929587]	Chr1:11146798 [GRCh38] Chr1:11206855 [GRCh37] Chr1:1p36.22	uncertain significance
NM_004958.4(MTOR):c.4731_4732delinsAG (p.Met1578Val)	indel	not provided [RCV001864668]\|not specified [RCV004690153]	Chr1:11145000..11145001 [GRCh38] Chr1:11205057..11205058 [GRCh37] Chr1:1p36.22	uncertain significance
NM_004958.4(MTOR):c.4802A>C (p.Glu1601Ala)	single nucleotide variant	not provided [RCV002003050]	Chr1:11144718 [GRCh38] Chr1:11204775 [GRCh37] Chr1:1p36.22	uncertain significance
NM_004958.4(MTOR):c.4587G>C (p.Met1529Ile)	single nucleotide variant	not provided [RCV002039310]	Chr1:11146775 [GRCh38] Chr1:11206832 [GRCh37] Chr1:1p36.22	uncertain significance
NM_004958.4(MTOR):c.4613G>A (p.Arg1538Gln)	single nucleotide variant	not provided [RCV001981256]	Chr1:11146749 [GRCh38] Chr1:11206806 [GRCh37] Chr1:1p36.22	uncertain significance
NM_004958.4(MTOR):c.4658A>G (p.His1553Arg)	single nucleotide variant	not provided [RCV002030542]	Chr1:11146704 [GRCh38] Chr1:11206761 [GRCh37] Chr1:1p36.22	uncertain significance
NM_004958.4(MTOR):c.4835G>A (p.Arg1612Gln)	single nucleotide variant	MTOR-related disorder [RCV003407878]\|not provided [RCV001880961]	Chr1:11144685 [GRCh38] Chr1:11204742 [GRCh37] Chr1:1p36.22	benign\|uncertain significance
NM_004958.4(MTOR):c.4765-5A>G	single nucleotide variant	not provided [RCV001899031]	Chr1:11144760 [GRCh38] Chr1:11204817 [GRCh37] Chr1:1p36.22	likely benign\|uncertain significance
NM_004958.4(MTOR):c.4778G>C (p.Cys1593Ser)	single nucleotide variant	not provided [RCV001922563]	Chr1:11144742 [GRCh38] Chr1:11204799 [GRCh37] Chr1:1p36.22	uncertain significance
NM_004958.4(MTOR):c.4620C>T (p.Thr1540=)	single nucleotide variant	not provided [RCV002145266]	Chr1:11146742 [GRCh38] Chr1:11206799 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4872+15A>C	single nucleotide variant	not provided [RCV002073762]	Chr1:11144633 [GRCh38] Chr1:11204690 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4869G>A (p.Leu1623=)	single nucleotide variant	not provided [RCV002189394]	Chr1:11144651 [GRCh38] Chr1:11204708 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4726A>T (p.Thr1576Ser)	single nucleotide variant	not provided [RCV002224906]	Chr1:11145006 [GRCh38] Chr1:11205063 [GRCh37] Chr1:1p36.22	uncertain significance
NM_004958.4(MTOR):c.4872+19C>T	single nucleotide variant	not provided [RCV002206397]	Chr1:11144629 [GRCh38] Chr1:11204686 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4571-9T>C	single nucleotide variant	not provided [RCV002148252]	Chr1:11146800 [GRCh38] Chr1:11206857 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4571-6G>A	single nucleotide variant	not provided [RCV002077764]	Chr1:11146797 [GRCh38] Chr1:11206854 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4837G>C (p.Glu1613Gln)	single nucleotide variant	not provided [RCV002132148]	Chr1:11144683 [GRCh38] Chr1:11204740 [GRCh37] Chr1:1p36.22	benign
NM_004958.4(MTOR):c.4571-16_4571-15del	deletion	not provided [RCV002136905]	Chr1:11146806..11146807 [GRCh38] Chr1:11206863..11206864 [GRCh37] Chr1:1p36.22	benign
NM_004958.4(MTOR):c.4686+14T>C	single nucleotide variant	not provided [RCV002121348]	Chr1:11146662 [GRCh38] Chr1:11206719 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4765-17C>T	single nucleotide variant	not provided [RCV002098316]	Chr1:11144772 [GRCh38] Chr1:11204829 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4872+20C>G	single nucleotide variant	not provided [RCV002100575]	Chr1:11144628 [GRCh38] Chr1:11204685 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4571-16A>G	single nucleotide variant	not provided [RCV002118934]	Chr1:11146807 [GRCh38] Chr1:11206864 [GRCh37] Chr1:1p36.22	benign
NM_004958.4(MTOR):c.4686+17A>G	single nucleotide variant	not provided [RCV002098048]	Chr1:11146659 [GRCh38] Chr1:11206716 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4765-14T>C	single nucleotide variant	not provided [RCV002157641]	Chr1:11144769 [GRCh38] Chr1:11204826 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4872+20C>T	single nucleotide variant	not provided [RCV002138357]	Chr1:11144628 [GRCh38] Chr1:11204685 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4686+12C>A	single nucleotide variant	not provided [RCV002178484]	Chr1:11146664 [GRCh38] Chr1:11206721 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4647G>C (p.Val1549=)	single nucleotide variant	not provided [RCV002202213]	Chr1:11146715 [GRCh38] Chr1:11206772 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4719T>C (p.Ala1573=)	single nucleotide variant	not provided [RCV002219662]	Chr1:11145013 [GRCh38] Chr1:11205070 [GRCh37] Chr1:1p36.22	likely benign
NC_000001.11:g.10115497_16283149dup	duplication	not specified [RCV002286386]	Chr1:10115497..16283149 [GRCh38] Chr1:1p36.22-36.13	likely pathogenic
NM_004958.4(MTOR):c.4792G>C (p.Glu1598Gln)	single nucleotide variant	not provided [RCV002303708]	Chr1:11144728 [GRCh38] Chr1:11204785 [GRCh37] Chr1:1p36.22	uncertain significance
NM_004958.4(MTOR):c.4834C>T (p.Arg1612Ter)	single nucleotide variant	not provided [RCV003034473]	Chr1:11144686 [GRCh38] Chr1:11204743 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4765-16G>A	single nucleotide variant	not provided [RCV002948251]	Chr1:11144771 [GRCh38] Chr1:11204828 [GRCh37] Chr1:1p36.22	benign\|uncertain significance
NM_004958.4(MTOR):c.4571-4A>G	single nucleotide variant	not provided [RCV002881729]	Chr1:11146795 [GRCh38] Chr1:11206852 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4850A>G (p.Gln1617Arg)	single nucleotide variant	not provided [RCV002881893]	Chr1:11144670 [GRCh38] Chr1:11204727 [GRCh37] Chr1:1p36.22	benign
NM_004958.4(MTOR):c.4686+5A>C	single nucleotide variant	not provided [RCV002858196]	Chr1:11146671 [GRCh38] Chr1:11206728 [GRCh37] Chr1:1p36.22	uncertain significance
NM_004958.4(MTOR):c.4765-5A>T	single nucleotide variant	not provided [RCV002838512]	Chr1:11144760 [GRCh38] Chr1:11204817 [GRCh37] Chr1:1p36.22	benign
NM_004958.4(MTOR):c.4707C>T (p.Asp1569=)	single nucleotide variant	not provided [RCV003006145]	Chr1:11145025 [GRCh38] Chr1:11205082 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4686+20C>G	single nucleotide variant	not provided [RCV002957558]	Chr1:11146656 [GRCh38] Chr1:11206713 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4686+4A>G	single nucleotide variant	not provided [RCV002899030]	Chr1:11146672 [GRCh38] Chr1:11206729 [GRCh37] Chr1:1p36.22	uncertain significance
NM_004958.4(MTOR):c.4730C>T (p.Ala1577Val)	single nucleotide variant	not provided [RCV002937608]	Chr1:11145002 [GRCh38] Chr1:11205059 [GRCh37] Chr1:1p36.22	uncertain significance
NM_004958.4(MTOR):c.4690A>G (p.Ile1564Val)	single nucleotide variant	not provided [RCV002585250]	Chr1:11145042 [GRCh38] Chr1:11205099 [GRCh37] Chr1:1p36.22	benign\|uncertain significance
NM_004958.4(MTOR):c.4842C>T (p.Ile1614=)	single nucleotide variant	not provided [RCV002814958]	Chr1:11144678 [GRCh38] Chr1:11204735 [GRCh37] Chr1:1p36.22	likely benign
GRCh38/hg38 1p36.33-35.1(chr1:99125-34026935)x3	copy number gain	Trisomy 12p [RCV003447845]	Chr1:99125..34026935 [GRCh38] Chr1:1p36.33-35.1	pathogenic
NM_004958.4(MTOR):c.4571-3T>C	single nucleotide variant	not provided [RCV003874768]	Chr1:11146794 [GRCh38] Chr1:11206851 [GRCh37] Chr1:1p36.22	uncertain significance
NM_004958.4(MTOR):c.4571-14GT[4]	microsatellite	not provided [RCV003688666]	Chr1:11146796..11146797 [GRCh38] Chr1:11206853..11206854 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4571-20_4571-17del	deletion	not provided [RCV003695728]	Chr1:11146808..11146811 [GRCh38] Chr1:11206865..11206868 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4730C>G (p.Ala1577Gly)	single nucleotide variant	not provided [RCV003576655]	Chr1:11145002 [GRCh38] Chr1:11205059 [GRCh37] Chr1:1p36.22	uncertain significance
NM_004958.4(MTOR):c.4764+17C>G	single nucleotide variant	not provided [RCV003716700]	Chr1:11144951 [GRCh38] Chr1:11205008 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4596C>T (p.Tyr1532=)	single nucleotide variant	not provided [RCV003879984]	Chr1:11146766 [GRCh38] Chr1:11206823 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4765-16G>T	single nucleotide variant	not provided [RCV003579733]	Chr1:11144771 [GRCh38] Chr1:11204828 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4824C>T (p.Val1608=)	single nucleotide variant	not provided [RCV003726728]	Chr1:11144696 [GRCh38] Chr1:11204753 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4791C>G (p.Ser1597=)	single nucleotide variant	not provided [RCV003664013]	Chr1:11144729 [GRCh38] Chr1:11204786 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4599C>T (p.Thr1533=)	single nucleotide variant	not provided [RCV003725368]	Chr1:11146763 [GRCh38] Chr1:11206820 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4740A>T (p.Gly1580=)	single nucleotide variant	not provided [RCV003550343]	Chr1:11144992 [GRCh38] Chr1:11205049 [GRCh37] Chr1:1p36.22	uncertain significance
NM_004958.4(MTOR):c.4687-17G>T	single nucleotide variant	not provided [RCV003737857]	Chr1:11145062 [GRCh38] Chr1:11205119 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4601G>A (p.Cys1534Tyr)	single nucleotide variant	not provided [RCV003721421]	Chr1:11146761 [GRCh38] Chr1:11206818 [GRCh37] Chr1:1p36.22	uncertain significance
NM_004958.4(MTOR):c.4771_4785del (p.Val1591_Met1595del)	deletion	not provided [RCV003685468]	Chr1:11144735..11144749 [GRCh38] Chr1:11204792..11204806 [GRCh37] Chr1:1p36.22	uncertain significance
NM_004958.4(MTOR):c.4668C>A (p.Leu1556=)	single nucleotide variant	not provided [RCV003870744]	Chr1:11146694 [GRCh38] Chr1:11206751 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4605G>A (p.Met1535Ile)	single nucleotide variant	MTOR-related disorder [RCV003982782]	Chr1:11146757 [GRCh38] Chr1:11206814 [GRCh37] Chr1:1p36.22	uncertain significance
NM_004958.4(MTOR):c.4794G>A (p.Glu1598=)	single nucleotide variant	MTOR-related disorder [RCV003944152]	Chr1:11144726 [GRCh38] Chr1:11204783 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4732A>G (p.Met1578Val)	single nucleotide variant	not specified [RCV004587964]	Chr1:11145000 [GRCh38] Chr1:11205057 [GRCh37] Chr1:1p36.22	uncertain significance
NM_004958.4(MTOR):c.4872G>C (p.Gln1624His)	single nucleotide variant	Isolated focal cortical dysplasia type II [RCV004764497]	Chr1:11144648 [GRCh38] Chr1:11204705 [GRCh37] Chr1:1p36.22	uncertain significance
NM_004958.4(MTOR):c.4764+11A>G	single nucleotide variant	not provided [RCV005086791]	Chr1:11144957 [GRCh38] Chr1:11205014 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4686+11A>G	single nucleotide variant	not provided [RCV005066100]	Chr1:11146665 [GRCh38] Chr1:11206722 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4762G>A (p.Gly1588Arg)	single nucleotide variant	not provided [RCV005229512]	Chr1:11144970 [GRCh38] Chr1:11205027 [GRCh37] Chr1:1p36.22	uncertain significance
NM_004958.4(MTOR):c.4686+10T>C	single nucleotide variant	not provided [RCV005126052]	Chr1:11146666 [GRCh38] Chr1:11206723 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4832G>A (p.Arg1611Gln)	single nucleotide variant	not provided [RCV005113543]	Chr1:11144688 [GRCh38] Chr1:11204745 [GRCh37] Chr1:1p36.22	uncertain significance
NM_004958.4(MTOR):c.4872+3G>C	single nucleotide variant	not provided [RCV005205083]	Chr1:11144645 [GRCh38] Chr1:11204702 [GRCh37] Chr1:1p36.22	uncertain significance
NM_004958.4(MTOR):c.4764+14A>G	single nucleotide variant	not provided [RCV005156929]	Chr1:11144954 [GRCh38] Chr1:11205011 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4571-12G>T	single nucleotide variant	not provided [RCV005168931]	Chr1:11146803 [GRCh38] Chr1:11206860 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4609C>T (p.Pro1537Ser)	single nucleotide variant	not provided [RCV005113544]	Chr1:11146753 [GRCh38] Chr1:11206810 [GRCh37] Chr1:1p36.22	uncertain significance
NM_004958.4(MTOR):c.4829A>C (p.Glu1610Ala)	single nucleotide variant	not provided [RCV005190426]	Chr1:11144691 [GRCh38] Chr1:11204748 [GRCh37] Chr1:1p36.22	uncertain significance
NM_004958.4(MTOR):c.4665C>T (p.Asp1555=)	single nucleotide variant	not provided [RCV005140474]	Chr1:11146697 [GRCh38] Chr1:11206754 [GRCh37] Chr1:1p36.22	likely benign
NM_004958.4(MTOR):c.4691T>C (p.Ile1564Thr)	single nucleotide variant	not provided [RCV005072139]	Chr1:11145041 [GRCh38] Chr1:11205098 [GRCh37] Chr1:1p36.22	uncertain significance

Predicted Target Of

	Summary Value
Count of predictions:	224
Count of miRNA genes:	115
Interacting mature miRNAs:	115
Transcripts:	ENST00000420480, ENST00000445982
Prediction methods:	Microtar, Miranda, Rnahybrid
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1298451	OSTEAR17_H	Osteoarthritis QTL 17 (human)	2.4	0.0004	Joint/bone inflammation	osteoarthritis	11	1	25188105	Human
597532685	GWAS1628759_H	body mass index QTL GWAS1628759 (human)		2e-10	body mass index	body mass index (BMI) (CMO:0000105)	1	11147212	11147213	Human
1576329	MYI9_H	Myocardial infarction susceptibility QTL 9 (human)	12		Myocardial infarction susceptibility	early-onset	1	7585503	33585503	Human
597493428	GWAS1589502_H	breast density QTL GWAS1589502 (human)		0.000008	breast density		1	11145475	11145476	Human
597461590	GWAS1557664_H	body mass index QTL GWAS1557664 (human)		2e-11	body mass index	body mass index (BMI) (CMO:0000105)	1	11147212	11147213	Human
1298463	BP9_H	Blood pressure QTL 9 (human)	3.9		Blood pressure	hypertension susceptibility	1	1	25188105	Human
1576325	MYI1_H	Myocardial infarction susceptibility QTL 1 (human)	11.68	1e-12	Myocardial infarction susceptibility	early-onset	1	7585503	33585503	Human
1643380	BW316_H	Body weight QTL 316 (human)	2.62	0.0002	Body weight	BMI	1	7585503	33585503	Human

Click on a value in the shaded box below the category label to view a detailed expression data table for that system.

adipose tissue	alimentary part of gastrointestinal system	appendage	circulatory system	ectoderm	endocrine system	endoderm	entire extraembryonic component	exocrine system	hemolymphoid system	hepatobiliary system	integumental system	mesenchyme	mesoderm	musculoskeletal system	nervous system	renal system	reproductive system	respiratory system	sensory system
527	774	1373	783	2191	723	951	3	195	638	125	1334	2330	2308	31	1576	308	880	716	74


RefSeq Transcripts	NG_033239	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	NR_046600	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AL391561	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	BG198268	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CP068277	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Ensembl Acc Id:

ENST00000420480

Type:

CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38.p14 Ensembl	1	11,144,424 - 11,149,537 (+)	Ensembl

Ensembl Acc Id:

ENST00000445982

Type:

CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38.p14 Ensembl	1	11,143,898 - 11,149,537 (+)	Ensembl

RefSeq Acc Id:

NR_046600

RefSeq Status:

VALIDATED

Type:

NON-CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38	1	11,143,898 - 11,149,538 (+)	NCBI
GRCh37	1	11,203,955 - 11,209,595 (+)	NCBI
HuRef	1	10,355,265 - 10,360,907 (+)	NCBI
CHM1_1	1	11,191,914 - 11,197,554 (+)	NCBI
T2T-CHM13v2.0	1	10,685,476 - 10,691,116 (+)	NCBI

Sequence:

show sequence

AATGGGATAACTGGCCATCCTTCCCAGAACATTTAGACTCCTGACTCCCAGACCTGGAGTGACAGTTTCTCATGTTAAAATGATCAGAATATCTGGCGGATGATCTCTCGTCGCTCGGGGACAAGTTT
GTACTGGATAACCTCCTCCAGCTCGGACAGCATGTGGCAAGAAACCATGGCCTGATGGAAGCAAATCGCATTCCAAACTAATTACTGCACGAACAATCCAAAAGACAGGATTAATTTAAATCATTCCT
TCTGGTGTCAGGGTATCTGCCGATCAGAGAAAACAGGCATGTTTCCAGCAGCCTGGATGAAAAGAGAAATTCGCTGAAGAAGGGCATTTTCCCAGAACTGAATGGCTTGAGAGGAGGTATTATCCAAT
TTCTCATCGAAGACAGAAATGTATGGCATCCAAAACTTTAACATCTATCTAAGGATGGGGCTGGTTACCAGAAAGACCAAGTAATTATCGGGTTTGAACTTTCAGCCCTGTCCACTGACATCCAGGAA
AGGTGAAGAGGTTGAAAATGAAAGGCAATAAAAACTCTTGAACAATGAGCTTCCAGGTTGATGAAGGTGCTGGGAGGGTGAAGGTAAACCCCAGTACCACAGGACAGAAGCTTCTGCACTCCAGACCC
TTCTAGACCTTCCCTCATTGTACCTGTTCACCTCTATCTTTTATAATACCCTTTATAATAAACAAG

hide sequence

Database	Acc Id	Source(s)
COSMIC	MTOR-AS1	COSMIC
Ensembl Genes	ENSG00000225602	Ensembl, ENTREZGENE
Ensembl Transcript	ENST00000445982	ENTREZGENE
GTEx	ENSG00000225602	GTEx
HGNC ID	HGNC:40242	ENTREZGENE
Human Proteome Map	MTOR-AS1	Human Proteome Map
NCBI Gene	MTOR-AS1	ENTREZGENE
RNAcentral	URS00001F522B	RNACentral
	URS000059B140	RNACentral
	URS000075B5BB	RNACentral

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2012-08-21	MTOR-AS1	MTOR antisense RNA 1	MTOR-AS1	MTOR antisense RNA 1 (non-protein coding)	Symbol and/or name change	5135510	APPROVED

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailable


InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailable


Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
		Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable

Send us a Message

Imported Disease Annotations - ClinVar