Symbol:
Rpl41
Name:
ribosomal protein L41
RGD ID:
621210
Description:
Predicted to enable mRNA 3'-UTR binding activity and mRNA 5'-UTR binding activity. Predicted to be a structural constituent of ribosome. Predicted to be involved in cytoplasmic translation. Predicted to be located in endoplasmic reticulum. Predicted to be part of cytosolic large ribosomal subunit. Orthologous to human RPL41 (ribosomal protein L41); INTERACTS WITH 1,3,5-trinitro-1,3,5-triazinane; 2,3,7,8-tetrachlorodibenzodioxine; aflatoxin B1.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
60S ribosomal protein L41; large ribosomal subunit protein eL41; small ribosomal subunit protein eS32
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Related Pseudogenes:
Rpl41-ps1
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 7 1,562,417 - 1,563,497 (-) NCBI GRCr8 mRatBN7.2 7 977,885 - 978,965 (-) NCBI mRatBN7.2 mRatBN7.2 UTH_Rnor_SHR_Utx 7 3,739,994 - 3,741,074 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 7 5,615,985 - 5,617,065 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 7 5,913,600 - 5,914,680 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 7 2,972,897 - 2,973,977 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 7 2,972,900 - 2,973,977 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 7 2,946,525 - 2,947,605 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 7 1,839,972 - 1,840,963 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 7 1,839,971 - 1,840,963 (-) NCBI Celera 7 848,464 - 849,544 (-) NCBI Celera Cytogenetic Map 7 q11 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Rpl41 Rat 1,2,4-trichloro-5-(2,5-dichlorophenyl)benzene multiple interactions ISO Rpl41 (Mus musculus) 6480464 [2 more ... CTD PMID:25510870 Rpl41 Rat 1,3,5-trinitro-1,3,5-triazinane increases expression EXP 6480464 cyclonite results in increased expression of RPL41 mRNA CTD PMID:25559034 Rpl41 Rat 17beta-estradiol multiple interactions ISO RPL41 (Homo sapiens) 6480464 3 more ... CTD PMID:11179685 Rpl41 Rat 17beta-estradiol decreases expression ISO RPL41 (Homo sapiens) 6480464 Estradiol results in decreased expression of RPL41 mRNA CTD PMID:11179685 and PMID:23019147 Rpl41 Rat 2,2',4,4',5,5'-hexachlorobiphenyl multiple interactions ISO Rpl41 (Mus musculus) 6480464 [2 more ... CTD PMID:25510870 Rpl41 Rat 2,2',4,4'-Tetrabromodiphenyl ether affects expression ISO Rpl41 (Mus musculus) 6480464 2 more ... CTD PMID:30294300 Rpl41 Rat 2,2',5,5'-tetrachlorobiphenyl multiple interactions ISO Rpl41 (Mus musculus) 6480464 [2 more ... CTD PMID:25510870 Rpl41 Rat 2,3',4,4',5-Pentachlorobiphenyl increases expression ISO Rpl41 (Mus musculus) 6480464 2 more ... CTD PMID:31388691 Rpl41 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO RPL41 (Homo sapiens) 6480464 Tetrachlorodibenzodioxin promotes the reaction [Estradiol results in decreased expression of RPL41 mRNA] CTD PMID:11179685 Rpl41 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of RPL41 mRNA CTD PMID:33387578 Rpl41 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of RPL41 mRNA CTD PMID:34747641 Rpl41 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of RPL41 mRNA CTD PMID:32109520 Rpl41 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Rpl41 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of RPL41 mRNA CTD PMID:21570461 Rpl41 Rat 2,4,4'-trichlorobiphenyl multiple interactions ISO Rpl41 (Mus musculus) 6480464 [2 more ... CTD PMID:25510870 Rpl41 Rat 2-hydroxypropanoic acid increases expression ISO RPL41 (Homo sapiens) 6480464 Lactic Acid results in increased expression of RPL41 mRNA CTD PMID:30851411 Rpl41 Rat 3,3'-diindolylmethane multiple interactions ISO RPL41 (Homo sapiens) 6480464 3 and 3'-diindolylmethane inhibits the reaction [Estradiol results in decreased expression of RPL41 mRNA] CTD PMID:11179685 Rpl41 Rat 4,4'-diaminodiphenylmethane affects expression ISO Rpl41 (Mus musculus) 6480464 4 and 4'-diaminodiphenylmethane affects the expression of RPL41 mRNA CTD PMID:18648102 Rpl41 Rat 4,4'-sulfonyldiphenol increases expression ISO Rpl41 (Mus musculus) 6480464 bisphenol S results in increased expression of RPL41 mRNA CTD PMID:39298647 Rpl41 Rat aflatoxin B1 decreases methylation ISO RPL41 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of RPL41 gene CTD PMID:27153756 Rpl41 Rat aflatoxin B1 increases expression EXP 6480464 Aflatoxin B1 results in increased expression of RPL41 mRNA CTD PMID:33354967 Rpl41 Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of RPL41 mRNA CTD PMID:16483693 Rpl41 Rat Aroclor 1254 increases expression ISO Rpl41 (Mus musculus) 6480464 Chlorodiphenyl (54% Chlorine) results in increased expression of RPL41 mRNA CTD PMID:23650126 Rpl41 Rat arsane affects methylation ISO RPL41 (Homo sapiens) 6480464 Arsenic affects the methylation of RPL41 gene CTD PMID:25304211 Rpl41 Rat arsenic atom affects methylation ISO RPL41 (Homo sapiens) 6480464 Arsenic affects the methylation of RPL41 gene CTD PMID:25304211 Rpl41 Rat arsenite(3-) multiple interactions ISO RPL41 (Homo sapiens) 6480464 arsenite promotes the reaction [G3BP1 protein binds to RPL41 mRNA] CTD PMID:32406909 Rpl41 Rat artesunate decreases response to substance ISO RPL41 (Homo sapiens) 6480464 RPL41 mRNA results in decreased susceptibility to artesunate CTD PMID:20144594 Rpl41 Rat benzo[a]pyrene multiple interactions ISO Rpl41 (Mus musculus) 6480464 Benzo(a)pyrene promotes the reaction [AHR protein binds to RPL41 promoter] CTD PMID:19654925 Rpl41 Rat beta-lapachone increases expression ISO RPL41 (Homo sapiens) 6480464 beta-lapachone results in increased expression of RPL41 mRNA CTD PMID:38218311 Rpl41 Rat bis(2-ethylhexyl) phthalate increases expression ISO Rpl41 (Mus musculus) 6480464 Diethylhexyl Phthalate results in increased expression of RPL41 mRNA CTD PMID:33754040 Rpl41 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of RPL41 mRNA CTD PMID:25181051 and PMID:32145629 Rpl41 Rat bisphenol A decreases expression ISO Rpl41 (Mus musculus) 6480464 bisphenol A results in decreased expression of RPL41 mRNA CTD PMID:35598803 and PMID:37611474 Rpl41 Rat bisphenol A increases expression ISO Rpl41 (Mus musculus) 6480464 bisphenol A results in increased expression of RPL41 mRNA CTD PMID:33221593 and PMID:38074096 Rpl41 Rat bisphenol A decreases expression ISO RPL41 (Homo sapiens) 6480464 bisphenol A results in decreased expression of RPL41 mRNA CTD PMID:38568856 Rpl41 Rat bisphenol A affects expression ISO RPL41 (Homo sapiens) 6480464 bisphenol A affects the expression of RPL41 mRNA CTD PMID:30903817 Rpl41 Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of RPL41 mRNA CTD PMID:30903817 Rpl41 Rat bisphenol AF decreases expression ISO Rpl41 (Mus musculus) 6480464 bisphenol AF results in decreased expression of RPL41 mRNA CTD PMID:37611474 Rpl41 Rat cadmium dichloride decreases methylation EXP 6480464 Cadmium Chloride results in decreased methylation of RPL41 promoter CTD PMID:22457795 Rpl41 Rat CGP 52608 multiple interactions ISO RPL41 (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to RPL41 gene] CTD PMID:28238834 Rpl41 Rat chloropicrin decreases expression ISO RPL41 (Homo sapiens) 6480464 chloropicrin results in decreased expression of RPL41 mRNA CTD PMID:26352163 Rpl41 Rat chlorpyrifos increases expression ISO Rpl41 (Mus musculus) 6480464 Chlorpyrifos results in increased expression of RPL41 mRNA CTD PMID:37019170 Rpl41 Rat cisplatin multiple interactions ISO RPL41 (Homo sapiens) 6480464 [Cisplatin co-treated with jinfukang] results in increased expression of RPL41 mRNA CTD PMID:27392435 Rpl41 Rat clofibric acid multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with Clofibric Acid] affects the expression of RPL41 mRNA CTD PMID:17602206 Rpl41 Rat copper(II) sulfate decreases expression ISO RPL41 (Homo sapiens) 6480464 Copper Sulfate results in decreased expression of RPL41 mRNA CTD PMID:19549813 Rpl41 Rat cylindrospermopsin increases expression ISO Rpl41 (Mus musculus) 6480464 cylindrospermopsin results in increased expression of RPL41 mRNA CTD PMID:20936652 Rpl41 Rat dehydroepiandrosterone decreases expression EXP 6480464 Dehydroepiandrosterone results in decreased expression of RPL41 mRNA CTD PMID:16940010 Rpl41 Rat dextran sulfate increases expression ISO Rpl41 (Mus musculus) 6480464 Dextran Sulfate results in increased expression of RPL41 mRNA CTD PMID:35093514 Rpl41 Rat dibutyl phthalate decreases expression ISO Rpl41 (Mus musculus) 6480464 Dibutyl Phthalate results in decreased expression of RPL41 mRNA CTD PMID:21266533 Rpl41 Rat dicrotophos decreases expression ISO RPL41 (Homo sapiens) 6480464 dicrotophos results in decreased expression of RPL41 mRNA CTD PMID:28302478 Rpl41 Rat enzyme inhibitor multiple interactions ISO RPL41 (Homo sapiens) 6480464 [Enzyme Inhibitors results in decreased activity of OGA protein] which results in increased O-linked glycosylation of RPL41 protein CTD PMID:23301498 Rpl41 Rat ethanol affects expression ISO Rpl41 (Mus musculus) 6480464 Ethanol affects the expression of RPL41 mRNA CTD PMID:30319688 Rpl41 Rat glafenine increases expression EXP 6480464 Glafenine results in increased expression of RPL41 mRNA CTD PMID:24136188 Rpl41 Rat hydralazine multiple interactions ISO RPL41 (Homo sapiens) 6480464 [Hydralazine co-treated with Valproic Acid] results in increased expression of RPL41 mRNA CTD PMID:17183730 Rpl41 Rat leflunomide decreases expression ISO Rpl41 (Mus musculus) 6480464 leflunomide results in decreased expression of RPL41 mRNA CTD PMID:19751817 Rpl41 Rat maneb multiple interactions ISO Rpl41 (Mus musculus) 6480464 [Paraquat co-treated with Maneb] results in decreased expression of RPL41 mRNA CTD PMID:18386188 Rpl41 Rat methylparaben decreases expression ISO RPL41 (Homo sapiens) 6480464 methylparaben results in decreased expression of RPL41 mRNA CTD PMID:38568856 Rpl41 Rat N-nitrosodiethylamine multiple interactions ISO Rpl41 (Mus musculus) 6480464 MET protein inhibits the reaction [Diethylnitrosamine results in increased expression of RPL41 mRNA] CTD PMID:17942915 Rpl41 Rat N-nitrosodiethylamine increases expression ISO Rpl41 (Mus musculus) 6480464 Diethylnitrosamine results in increased expression of RPL41 mRNA CTD PMID:17942915 Rpl41 Rat N-nitrosodiethylamine multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with Clofibric Acid] affects the expression of RPL41 mRNA CTD PMID:17602206 Rpl41 Rat ozone multiple interactions ISO Rpl41 (Mus musculus) 6480464 [Air Pollutants results in increased abundance of [Ozone co-treated with Soot]] which results in increased expression of RPL41 mRNA CTD PMID:34911549 Rpl41 Rat paraquat multiple interactions ISO Rpl41 (Mus musculus) 6480464 [Paraquat co-treated with Maneb] results in decreased expression of RPL41 mRNA CTD PMID:18386188 Rpl41 Rat PCB138 multiple interactions ISO Rpl41 (Mus musculus) 6480464 [2 more ... CTD PMID:25510870 Rpl41 Rat PhIP increases expression EXP 6480464 2-amino-1-methyl-6-phenylimidazo(4 and 5-b)pyridine results in increased expression of RPL41 mRNA CTD PMID:15215175 Rpl41 Rat pirinixic acid decreases expression EXP 6480464 pirinixic acid results in decreased expression of RPL41 mRNA CTD PMID:16940010 Rpl41 Rat potassium dichromate increases expression ISO RPL41 (Homo sapiens) 6480464 Potassium Dichromate results in increased expression of RPL41 mRNA CTD PMID:11678601 Rpl41 Rat rac-lactic acid increases expression ISO RPL41 (Homo sapiens) 6480464 Lactic Acid results in increased expression of RPL41 mRNA CTD PMID:30851411 Rpl41 Rat resveratrol multiple interactions ISO RPL41 (Homo sapiens) 6480464 [Plant Extracts co-treated with Resveratrol] results in decreased expression of RPL41 mRNA and [Plant Extracts co-treated with Resveratrol] results in increased expression of RPL41 mRNA CTD PMID:23557933 Rpl41 Rat rimonabant multiple interactions ISO Rpl41 (Mus musculus) 6480464 Rimonabant inhibits the reaction [Dietary Fats results in decreased expression of RPL41 mRNA] CTD PMID:19030233 Rpl41 Rat silicon dioxide decreases expression ISO Rpl41 (Mus musculus) 6480464 Silicon Dioxide results in decreased expression of RPL41 mRNA CTD PMID:19073995 Rpl41 Rat sodium arsenite decreases expression ISO Rpl41 (Mus musculus) 6480464 sodium arsenite results in decreased expression of RPL41 mRNA CTD PMID:36209798 Rpl41 Rat tetrachloromethane affects expression EXP 6480464 Carbon Tetrachloride affects the expression of RPL41 mRNA CTD PMID:15963342 and PMID:16239168 Rpl41 Rat tetrachloromethane decreases expression EXP 6480464 Carbon Tetrachloride results in decreased expression of RPL41 mRNA CTD PMID:33387578 Rpl41 Rat titanium dioxide decreases methylation ISO Rpl41 (Mus musculus) 6480464 titanium dioxide results in decreased methylation of RPL41 gene CTD PMID:35295148 Rpl41 Rat tolcapone decreases expression EXP 6480464 tolcapone results in decreased expression of RPL41 mRNA CTD PMID:24136188 Rpl41 Rat triphenyl phosphate affects expression ISO RPL41 (Homo sapiens) 6480464 triphenyl phosphate affects the expression of RPL41 mRNA CTD PMID:37042841 Rpl41 Rat tris(2-butoxyethyl) phosphate increases expression ISO RPL41 (Homo sapiens) 6480464 tris(2-butoxyethyl) phosphate results in increased expression of RPL41 mRNA CTD PMID:29024780 Rpl41 Rat tungsten increases expression ISO Rpl41 (Mus musculus) 6480464 Tungsten results in increased expression of RPL41 mRNA CTD PMID:30912803 Rpl41 Rat valproic acid increases methylation ISO RPL41 (Homo sapiens) 6480464 Valproic Acid results in increased methylation of RPL41 gene CTD PMID:29154799 Rpl41 Rat valproic acid multiple interactions ISO RPL41 (Homo sapiens) 6480464 [Hydralazine co-treated with Valproic Acid] results in increased expression of RPL41 mRNA CTD PMID:17183730 Rpl41 Rat vinclozolin decreases expression EXP 6480464 vinclozolin results in decreased expression of RPL41 mRNA CTD PMID:23034163
1,2,4-trichloro-5-(2,5-dichlorophenyl)benzene (ISO) 1,3,5-trinitro-1,3,5-triazinane (EXP) 17beta-estradiol (ISO) 2,2',4,4',5,5'-hexachlorobiphenyl (ISO) 2,2',4,4'-Tetrabromodiphenyl ether (ISO) 2,2',5,5'-tetrachlorobiphenyl (ISO) 2,3',4,4',5-Pentachlorobiphenyl (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4,4'-trichlorobiphenyl (ISO) 2-hydroxypropanoic acid (ISO) 3,3'-diindolylmethane (ISO) 4,4'-diaminodiphenylmethane (ISO) 4,4'-sulfonyldiphenol (ISO) aflatoxin B1 (EXP,ISO) ammonium chloride (EXP) Aroclor 1254 (ISO) arsane (ISO) arsenic atom (ISO) arsenite(3-) (ISO) artesunate (ISO) benzo[a]pyrene (ISO) beta-lapachone (ISO) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) bisphenol AF (ISO) cadmium dichloride (EXP) CGP 52608 (ISO) chloropicrin (ISO) chlorpyrifos (ISO) cisplatin (ISO) clofibric acid (EXP) copper(II) sulfate (ISO) cylindrospermopsin (ISO) dehydroepiandrosterone (EXP) dextran sulfate (ISO) dibutyl phthalate (ISO) dicrotophos (ISO) enzyme inhibitor (ISO) ethanol (ISO) glafenine (EXP) hydralazine (ISO) leflunomide (ISO) maneb (ISO) methylparaben (ISO) N-nitrosodiethylamine (EXP,ISO) ozone (ISO) paraquat (ISO) PCB138 (ISO) PhIP (EXP) pirinixic acid (EXP) potassium dichromate (ISO) rac-lactic acid (ISO) resveratrol (ISO) rimonabant (ISO) silicon dioxide (ISO) sodium arsenite (ISO) tetrachloromethane (EXP) titanium dioxide (ISO) tolcapone (EXP) triphenyl phosphate (ISO) tris(2-butoxyethyl) phosphate (ISO) tungsten (ISO) valproic acid (ISO) vinclozolin (EXP)
Rpl41 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 7 1,562,417 - 1,563,497 (-) NCBI GRCr8 mRatBN7.2 7 977,885 - 978,965 (-) NCBI mRatBN7.2 mRatBN7.2 UTH_Rnor_SHR_Utx 7 3,739,994 - 3,741,074 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 7 5,615,985 - 5,617,065 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 7 5,913,600 - 5,914,680 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 7 2,972,897 - 2,973,977 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 7 2,972,900 - 2,973,977 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 7 2,946,525 - 2,947,605 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 7 1,839,972 - 1,840,963 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 7 1,839,971 - 1,840,963 (-) NCBI Celera 7 848,464 - 849,544 (-) NCBI Celera Cytogenetic Map 7 q11 NCBI
RPL41 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 12 56,116,633 - 56,117,967 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 12 56,116,590 - 56,117,967 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 12 56,510,417 - 56,511,751 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 12 54,796,641 - 54,797,883 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 12 54,796,640 - 54,797,882 NCBI Celera 12 56,162,519 - 56,163,761 (+) NCBI Celera Cytogenetic Map 12 q13.2 NCBI HuRef 12 53,549,507 - 53,550,749 (+) NCBI HuRef CHM1_1 12 56,477,739 - 56,478,981 (+) NCBI CHM1_1 T2T-CHM13v2.0 12 56,084,231 - 56,085,565 (+) NCBI T2T-CHM13v2.0
Rpl41 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 10 128,383,979 - 128,385,037 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 10 128,383,983 - 128,385,174 (-) Ensembl GRCm39 Ensembl GRCm38 10 128,548,110 - 128,549,168 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 10 128,548,114 - 128,549,305 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 10 127,985,166 - 127,986,224 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 10 127,951,066 - 127,952,065 (-) NCBI MGSCv36 mm8 Celera 10 130,940,061 - 130,941,119 (-) NCBI Celera Cytogenetic Map 10 D3 NCBI cM Map 10 77.04 NCBI
RPL41 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 10 38,213,886 - 38,215,089 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 12 38,210,654 - 38,211,856 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 12 32,797,176 - 32,798,407 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 12 33,047,799 - 33,049,040 (-) NCBI panpan1.1 PanPan1.1 panPan2
.
Predicted Target Of
Count of predictions: 86 Count of miRNA genes: 70 Interacting mature miRNAs: 80 Transcripts: ENSRNOT00000066159 Prediction methods: Microtar, Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
61410 Bw19 Body weight QTL 19 6.2 0.001 body mass (VT:0001259) body weight (CMO:0000012) 7 1 44782185 Rat 1300176 Hrtrt10 Heart rate QTL 10 3.19 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 7 664270 26029351 Rat 2317047 Wbc4 White blood cell count QTL 4 0.01 leukocyte quantity (VT:0000217) white blood cell count (CMO:0000027) 7 1 35342956 Rat 2298550 Neuinf6 Neuroinflammation QTL 6 3.3 nervous system integrity trait (VT:0010566) spinal cord RT1-B protein level (CMO:0002132) 7 1 27829089 Rat 631503 Bp102 Blood pressure QTL 102 1.9 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 7 1 44822433 Rat 634336 Anxrr17 Anxiety related response QTL 17 3.66 locomotor behavior trait (VT:0001392) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 7 924703 115097879 Rat 724560 Plsm3 Polydactyly-luxate syndrome (PLS) morphotypes QTL 3 0.0003 tibia length (VT:0004357) tibia length (CMO:0000450) 7 1 34000259 Rat 9590142 Scort5 Serum corticosterone level QTL 5 24.4 0.001 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 7 1 31962314 Rat 7411566 Bw136 Body weight QTL 136 10.4 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 7 1 31962314 Rat
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000066159 ⟹ ENSRNOP00000062398
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source Rnor_6.0 Ensembl 7 2,972,900 - 2,973,977 (-) Ensembl
RefSeq Acc Id:
NM_139083 ⟹ NP_620783
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 1,562,417 - 1,563,497 (-) NCBI mRatBN7.2 7 977,885 - 978,965 (-) NCBI Rnor_6.0 7 2,972,897 - 2,973,977 (-) NCBI Rnor_5.0 7 2,946,525 - 2,947,605 (-) NCBI RGSC_v3.4 7 1,839,972 - 1,840,963 (-) RGD Celera 7 848,464 - 849,544 (-) NCBI
Sequence:
ACGACACCAAGCACGCCATTAAATAGCAGTAGGCCGGACTCCCCGCTCTCTCGGTCTTAGCGCCATCTTCCTTGAGACTCCTGCGCCATGAGAGCGAAGTGGCGGAAGAAGAGAATGCGCAGGCTGAA
hide sequence
RefSeq Acc Id:
NP_620783 ⟸ NM_139083
- UniProtKB:
P62948 (UniProtKB/Swiss-Prot)
- Sequence:
Ensembl Acc Id:
ENSRNOP00000062398 ⟸ ENSRNOT00000066159
RGD ID: 13694943 Promoter ID: EPDNEW_R5468 Type: initiation region Name: Rpl41_1 Description: ribosomal protein L41 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 7 2,973,930 - 2,973,990 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2004-02-26
Rpl41
ribosomal protein L41
Symbol and Name status set to approved
625702 APPROVED
2002-08-07
Rpl41
ribosomal protein L41
Symbol and Name status set to provisional
70820 PROVISIONAL
