Symbol:
SERPINB12
Name:
serpin family B member 12
RGD ID:
18683355
Description:
ENCODES a protein that exhibits serine-type endopeptidase inhibitor activity (inferred); INVOLVED IN hematopoietic progenitor cell differentiation (inferred); ASSOCIATED WITH chromosome 18q deletion syndrome (ortholog); multiple congenital anomalies-hypotonia-seizures syndrome 1 (ortholog); FOUND IN cornified envelope (inferred); extracellular space (inferred)
Type:
protein-coding
RefSeq Status:
MODEL
Previously known as:
serpin B12
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
ChlSab1.1 - Green Monkey 1.1 Assembly
Position:
Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 18 16,193,673 - 16,208,866 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 18 16,194,694 - 16,206,029 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666060 9,483,861 - 9,496,030 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
JBrowse:
View Region in Genome Browser (JBrowse)
Model
SERPINB12 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 18 16,193,673 - 16,208,866 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 18 16,194,694 - 16,206,029 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666060 9,483,861 - 9,496,030 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
SERPINB12 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 18 63,519,110 - 63,569,329 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 18 63,542,369 - 63,569,329 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 18 61,209,602 - 61,236,562 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 18 59,374,373 - 59,385,224 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 18 59,374,372 - 59,385,224 NCBI Celera 18 57,943,890 - 57,954,746 (+) NCBI Celera Cytogenetic Map 18 q21.33 NCBI HuRef 18 57,923,215 - 57,934,075 (+) NCBI HuRef CHM1_1 18 61,219,374 - 61,230,454 (+) NCBI CHM1_1 T2T-CHM13v2.0 18 63,724,229 - 63,774,441 (+) NCBI T2T-CHM13v2.0
Serpinb12 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 1 106,862,179 - 106,884,810 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 1 106,862,179 - 106,884,810 (+) Ensembl GRCm39 Ensembl GRCm38 1 106,934,449 - 106,957,080 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 1 106,934,449 - 106,957,080 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 1 108,831,026 - 108,853,655 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 1 108,761,996 - 108,784,625 (+) NCBI MGSCv36 mm8 Celera 1 109,783,814 - 109,805,887 (+) NCBI Celera Cytogenetic Map 1 E2.1 NCBI cM Map 1 50.34 NCBI
Serpinb12 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 13 23,567,023 - 23,598,329 (+) NCBI GRCr8 mRatBN7.2 13 23,052,384 - 23,083,691 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 13 23,052,448 - 23,083,691 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 13 23,374,783 - 23,406,019 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 13 24,659,242 - 24,690,484 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 13 23,344,967 - 23,376,203 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 13 26,970,824 - 26,999,709 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 13 26,970,660 - 26,998,357 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 13 31,616,215 - 31,619,910 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 Rnor_5.0 13 32,119,751 - 32,147,132 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 13 13,106,080 - 13,137,360 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 Celera 13 22,909,857 - 22,938,862 (+) NCBI Celera Cytogenetic Map 13 p11 NCBI
Serpinb12 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955402 47,342,151 - 47,360,030 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955402 47,338,874 - 47,361,485 (+) NCBI ChiLan1.0 ChiLan1.0
SERPINB12 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 17 81,029,581 - 81,081,205 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 18 66,722,192 - 66,773,816 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 18 56,915,588 - 56,926,603 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 18 60,227,478 - 60,238,721 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 18 60,190,661 - 60,240,704 (+) Ensembl panpan1.1 panPan2
SERPINB12 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 1 13,516,993 - 13,539,834 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 1 13,518,850 - 13,539,956 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 1 14,476,959 - 14,501,163 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 1 13,371,247 - 13,395,525 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 1 13,374,489 - 13,395,606 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 1 13,409,543 - 13,433,747 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 1 13,338,833 - 13,363,115 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 1 13,587,695 - 13,611,747 (-) NCBI UU_Cfam_GSD_1.0
Serpinb12
SERPINB12
Serpinb12
.
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSCSAT00000016295 ⟹ ENSCSAP00000014214
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 Ensembl 18 16,194,694 - 16,206,029 (-) Ensembl
RefSeq Acc Id:
XM_008013860 ⟹ XP_008012051
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 18 16,193,673 - 16,206,343 (-) NCBI Vero_WHO_p1.0 NW_023666060 9,483,861 - 9,496,030 (+) NCBI
Sequence:
TAAACCACTCAGTCTCTGCTAATTTCTTATGGCAGCCCCAGGAAACAAATTCACACCACTAAATGAAAATAGATCCCTGTCTATCAATATCAATATCAATATCAATCAATAAATATCAATATCAACAC
hide sequence
RefSeq Acc Id:
XM_037988047 ⟹ XP_037843975
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source Vero_WHO_p1.0 NW_023666060 9,483,861 - 9,496,030 (+) NCBI
RefSeq Acc Id:
XP_008012051 ⟸ XM_008013860
- Peptide Label:
isoform X1
- UniProtKB:
A0A0D9S025 (UniProtKB/TrEMBL)
Ensembl Acc Id:
ENSCSAP00000014214 ⟸ ENSCSAT00000016295
RefSeq Acc Id:
XP_037843975 ⟸ XM_037988047
- Peptide Label:
isoform X2
- UniProtKB:
A0A0D9S025 (UniProtKB/TrEMBL)
