Symbol:
MED4
Name:
mediator complex subunit 4
RGD ID:
18519389
Description:
ENCODES a protein that exhibits nuclear thyroid hormone receptor binding (inferred); transcription coactivator activity (inferred); transcription coregulator activity (inferred); INVOLVED IN positive regulation of DNA-templated transcription (inferred); positive regulation of transcription initiation by RNA polymerase II (inferred); regulation of transcription by RNA polymerase II (inferred); PARTICIPATES IN RNA polymerase II transcription pathway; ASSOCIATED WITH cervical cancer (ortholog); chromosome 13q14 deletion syndrome (ortholog); endometriosis (ortholog); FOUND IN core mediator complex (inferred); mediator complex (inferred); nucleoplasm (inferred)
Type:
protein-coding
RefSeq Status:
MODEL
Previously known as:
mediator of RNA polymerase II transcription subunit 4
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
ChlSab1.1 - Green Monkey 1.1 Assembly
Position:
Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 3 25,990,203 - 26,009,472 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 3 25,990,159 - 26,009,438 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666057 17,900,930 - 17,920,167 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
JBrowse:
View Region in Genome Browser (JBrowse)
Model
MED4 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 3 25,990,203 - 26,009,472 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 3 25,990,159 - 26,009,438 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666057 17,900,930 - 17,920,167 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
MED4 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 13 48,075,724 - 48,095,104 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 13 48,053,323 - 48,095,131 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 13 48,649,860 - 48,669,240 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 13 47,548,093 - 47,567,241 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 13 47,548,092 - 47,567,241 NCBI Celera 13 29,704,843 - 29,723,982 (-) NCBI Celera Cytogenetic Map 13 q14.2 NCBI HuRef 13 29,441,920 - 29,461,323 (-) NCBI HuRef CHM1_1 13 48,617,590 - 48,636,992 (-) NCBI CHM1_1 T2T-CHM13v2.0 13 47,296,104 - 47,315,464 (-) NCBI T2T-CHM13v2.0
Med4 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 14 73,747,489 - 73,755,985 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 14 73,747,465 - 73,756,289 (+) Ensembl GRCm39 Ensembl GRCm38 14 73,510,049 - 73,518,545 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 14 73,510,025 - 73,518,849 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 14 73,909,856 - 73,918,352 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 14 72,244,204 - 72,252,700 (+) NCBI MGSCv36 mm8 Celera 14 71,030,090 - 71,038,619 (+) NCBI Celera Cytogenetic Map 14 D3 NCBI cM Map 14 39.05 NCBI
Med4 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 15 55,106,079 - 55,116,354 (+) NCBI GRCr8 mRatBN7.2 15 48,696,542 - 48,706,818 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 15 48,696,511 - 48,706,820 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 15 52,837,909 - 52,848,181 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 15 53,949,486 - 53,959,758 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 15 50,794,276 - 50,804,563 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 15 55,406,543 - 55,416,816 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 15 55,406,543 - 55,416,815 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 15 59,128,754 - 59,139,027 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 15 54,158,386 - 54,168,660 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 15 54,174,165 - 54,184,439 (+) NCBI Celera 15 48,344,958 - 48,355,232 (+) NCBI Celera Cytogenetic Map 15 q11 NCBI
Med4 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955431 1,794,115 - 1,812,889 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955431 1,794,863 - 1,812,641 (-) NCBI ChiLan1.0 ChiLan1.0
MED4 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 14 49,501,810 - 49,549,339 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 13 48,153,026 - 48,200,552 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 13 29,227,620 - 29,247,082 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 13 47,929,918 - 47,948,836 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 13 47,929,918 - 47,948,836 (-) Ensembl panpan1.1 panPan2
MED4 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 22 3,396,276 - 3,411,037 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 22 3,396,267 - 3,410,608 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 22 3,382,963 - 3,439,510 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 22 3,468,131 - 3,524,954 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 22 3,509,920 - 3,524,949 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 22 3,253,448 - 3,309,631 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 22 3,316,446 - 3,372,886 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 22 3,321,556 - 3,377,754 (+) NCBI UU_Cfam_GSD_1.0
Med4 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024404945 157,913,380 - 157,930,626 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936565 1,396,088 - 1,415,248 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936565 1,397,434 - 1,414,674 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
MED4 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 11 19,551,863 - 19,566,926 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 11 19,551,858 - 19,566,915 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 11 20,010,002 - 20,019,435 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
Med4
.
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSCSAT00000015838 ⟹ ENSCSAP00000013766
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 Ensembl 3 25,990,159 - 26,009,438 (-) Ensembl
RefSeq Acc Id:
XM_007960377 ⟹ XP_007958568
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 3 25,990,203 - 26,009,472 (-) NCBI Vero_WHO_p1.0 NW_023666057 17,900,930 - 17,920,167 (+) NCBI
Sequence:
ATGACTCTTCCGCCTTCCGAGTCCGCCTCCTCGCCACGCCCCTGCGTCAGCGCGCTCAGCGCGTGCGCCGGCGGCGGGGCTGTGAGGAAAATGGCTGCGTCTTCGAGTGGTGAGAAGGAGAAAGAGAG
hide sequence
RefSeq Acc Id:
XP_007958568 ⟸ XM_007960377
- UniProtKB:
A0A0D9RYS7 (UniProtKB/TrEMBL)
Ensembl Acc Id:
ENSCSAP00000013766 ⟸ ENSCSAT00000015838
