Advanced Search (OLGA)

Gene: STX8 (syntaxin 8) Chlorocebus sabaeus

Analyze

Symbol:

STX8

Name:

syntaxin 8

RGD ID:

18370392

Description:

ENCODES a protein that exhibits chloride channel inhibitor activity (ortholog); syntaxin binding (ortholog); ubiquitin protein ligase binding (ortholog); INVOLVED IN cellular response to type II interferon (ortholog); early endosome to late endosome transport (ortholog); endosome to lysosome transport (ortholog); ASSOCIATED WITH prostate cancer (ortholog); FOUND IN early endosome (ortholog); endosome (ortholog); late endosome (ortholog)

Type:

protein-coding

RefSeq Status:

MODEL

Previously known as:

syntaxin-8

RGD Orthologs

Alliance Orthologs

More Info

more info ...

More Info

Species	Gene symbol and name	Data Source	Assertion derived from	less info ...
Orthologs ¹				less info ...
Homo sapiens (human):	STX8 (syntaxin 8)	NCBI	Ortholog
Mus musculus (house mouse):	Stx8 (syntaxin 8)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Rattus norvegicus (Norway rat):	Stx8 (syntaxin 8)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):	Stx8 (syntaxin 8)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):	STX8 (syntaxin 8)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Canis lupus familiaris (dog):	STX8 (syntaxin 8)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):	Stx8 (syntaxin 8)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Sus scrofa (pig):	STX8 (syntaxin 8)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):	Stx8 (syntaxin 8)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline

Latest Assembly:

ChlSab1.1 - Green Monkey 1.1 Assembly

Position:

Green Monkey Assembly	Chr	Position (strand)	Source	Genome Browsers
Green Monkey Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
ChlSab1.1	16	8,613,551 - 8,937,428 (-)	NCBI	ChlSab1.1	ChlSab1.1	chlSab2
Vero_WHO_p1.0	NW_023666059	12,406,787 - 12,742,033 (+)	NCBI	Vero_WHO_p1.0	Vero_WHO_p1.0

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

prostate cancer (ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular response to type II interferon (ISO)

early endosome to late endosome transport (ISO)

endosome to lysosome transport (ISO)

regulation of protein localization to plasma membrane (ISO)

vesicle fusion (ISO)

vesicle-mediated transport (ISO)

Cellular Component

early endosome (ISO)

endosome (ISO)

late endosome (ISO)

late endosome membrane (ISO)

lysosomal membrane (ISO)

perinuclear region of cytoplasm (ISO)

phagocytic vesicle (ISO)

recycling endosome (ISO)

SNARE complex (ISO)

trans-Golgi network (ISO)

vesicle (ISO)

Molecular Function

chloride channel inhibitor activity (ISO)

protein binding (ISO)

syntaxin binding (ISO)

ubiquitin protein ligase binding (ISO)

References

Additional References at PubMed

PMID:30032202

Genomics

Comparative Map Data

STX8
(Chlorocebus sabaeus - green monkey)

Green Monkey Assembly	Chr	Position (strand)	Source	Genome Browsers
Green Monkey Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
ChlSab1.1	16	8,613,551 - 8,937,428 (-)	NCBI	ChlSab1.1	ChlSab1.1	chlSab2
Vero_WHO_p1.0	NW_023666059	12,406,787 - 12,742,033 (+)	NCBI	Vero_WHO_p1.0	Vero_WHO_p1.0

STX8
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	17	9,250,471 - 9,575,820 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	17	9,250,471 - 9,576,591 (-)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	17	9,153,788 - 9,479,137 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	17	9,094,513 - 9,420,000 (-)	NCBI	NCBI36	Build 36	hg18	NCBI36
Build 34	17	9,094,513 - 9,420,000	NCBI
Celera	17	9,185,566 - 9,511,610 (-)	NCBI		Celera
Cytogenetic Map	17	p13.1	NCBI
HuRef	17	9,052,731 - 9,379,133 (-)	NCBI		HuRef
CHM1_1	17	9,162,819 - 9,489,516 (-)	NCBI		CHM1_1
T2T-CHM13v2.0	17	9,157,469 - 9,484,308 (-)	NCBI		T2T-CHM13v2.0

Stx8
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	11	67,857,237 - 68,097,974 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	11	67,857,019 - 68,097,974 (+)	Ensembl		GRCm39 Ensembl
GRCm38	11	67,966,411 - 68,207,148 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	11	67,966,193 - 68,207,148 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	11	67,779,985 - 68,020,650 (+)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
MGSCv36	11	67,782,678 - 68,023,343 (+)	NCBI		MGSCv36	mm8
Celera	11	74,904,672 - 75,144,681 (+)	NCBI		Celera
Cytogenetic Map	11	B3	NCBI
cM Map	11	41.2	NCBI

Stx8
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	10	53,154,572 - 53,393,912 (+)	NCBI		GRCr8
mRatBN7.2	10	52,655,643 - 52,900,048 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	10	52,654,990 - 52,894,993 (+)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	10	57,324,601 - 57,561,500 (+)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	10	56,813,619 - 57,050,517 (+)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	10	52,312,324 - 52,551,325 (+)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	10	54,512,922 - 54,753,302 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	10	54,512,983 - 54,753,302 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	10	54,258,182 - 54,498,841 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
RGSC_v3.4	10	54,700,557 - 54,942,042 (+)	NCBI	RGSC3.4	RGSC_v3.4	rn4	RGSC3.4
RGSC_v3.1	10	54,714,179 - 54,955,665 (+)	NCBI
Celera	10	51,834,263 - 52,070,021 (+)	NCBI		Celera
Cytogenetic Map	10	q24	NCBI

Stx8
(Chinchilla lanigera - long-tailed chinchilla)

Chinchilla Assembly	Chr	Position (strand)	Source	Genome Browsers
Chinchilla Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
ChiLan1.0 Ensembl	NW_004955467	7,523,464 - 7,792,056 (+)	Ensembl	ChiLan1.0
ChiLan1.0	NW_004955467	7,524,223 - 7,789,630 (+)	NCBI	ChiLan1.0	ChiLan1.0

STX8
(Pan paniscus - bonobo/pygmy chimpanzee)

Bonobo Assembly	Chr	Position (strand)	Source	Genome Browsers
Bonobo Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
NHGRI_mPanPan1-v2	19	64,169,987 - 64,497,426 (+)	NCBI		NHGRI_mPanPan1-v2
NHGRI_mPanPan1	17	68,980,428 - 69,307,350 (+)	NCBI		NHGRI_mPanPan1
Mhudiblu_PPA_v0	17	42,076,600 - 42,403,334 (+)	NCBI	Mhudiblu_PPA_v0	Mhudiblu_PPA_v0	panPan3
PanPan1.1	17	46,816,709 - 47,141,923 (+)	NCBI	panpan1.1	PanPan1.1	panPan2
PanPan1.1 Ensembl	17	46,816,859 - 47,141,816 (+)	Ensembl	panpan1.1		panPan2

STX8
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	5	33,834,218 - 34,091,827 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	5	33,834,279 - 34,091,757 (-)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	5	33,970,462 - 34,228,208 (-)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	5	33,937,733 - 34,196,280 (-)	NCBI		ROS_Cfam_1.0
ROS_Cfam_1.0 Ensembl	5	33,937,794 - 34,196,194 (-)	Ensembl		ROS_Cfam_1.0 Ensembl
UMICH_Zoey_3.1	5	33,904,727 - 34,162,119 (-)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	5	33,862,380 - 34,120,132 (-)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	5	34,038,879 - 34,300,241 (-)	NCBI		UU_Cfam_GSD_1.0

Stx8
(Ictidomys tridecemlineatus - thirteen-lined ground squirrel)

Squirrel Assembly	Chr	Position (strand)	Source	Genome Browsers
Squirrel Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
HiC_Itri_2	NW_024405602	48,854,575 - 49,104,600 (-)	NCBI		HiC_Itri_2
SpeTri2.0 Ensembl	NW_004936595	2,328,740 - 2,578,791 (-)	Ensembl	SpeTri2.0	SpeTri2.0 Ensembl
SpeTri2.0	NW_004936595	2,328,763 - 2,578,788 (-)	NCBI	SpeTri2.0	SpeTri2.0		SpeTri2.0

STX8
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	12	54,296,995 - 54,544,646 (-)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	12	54,296,988 - 54,544,668 (-)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	12	57,133,672 - 57,198,153 (-)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

Stx8
(Heterocephalus glaber - naked mole-rat)

Naked Mole-Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Naked Mole-Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
HetGla 1.0	NW_004624786	11,712,667 - 11,992,201 (-)	NCBI	HetGla_female_1.0	HetGla 1.0	hetGla2

Expression

RNA-SEQ Expression

Click on a value in the shaded box below the category label to view a detailed expression data table for that system.

Sequence

Nucleotide Sequences


RefSeq Transcripts	XM_008010330	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	XM_008010331	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	JACDXN010000027	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

RefSeq Acc Id:

XM_008010330 ⟹ XP_008008521

Type:

CODING

Position:

Green Monkey Assembly	Chr	Position (strand)	Source
ChlSab1.1	16	8,613,551 - 8,937,428 (-)	NCBI
Vero_WHO_p1.0	NW_023666059	12,406,787 - 12,742,033 (+)	NCBI

Sequence:

show sequence

CATGGTTCTTAGGCTCTAGTTATCCACTTTGCAAACTCCAGGCTCCGGTCGCGCACGGGACGAA
CTGCGGGGAGTGAGCCGTGCGGGCCGCCGTAGTCAGCTGCTAAGAGCAGGAAGAGTCCGAGCGG
CGGGCGGAGTCTGCAGGATGGCACCGGACCCCTGGTTCTCCACATACGATTCTACTTGTCAAAT
TGCCCAAGAAATTGCTGAGAAAATTCAACAACGAAATCAGTATGAAAGAAAAGGTGAAAAGGCA
CCGAAGCTTACCGTGACAATCAGAGCTTTGTTGCAGAACCTGAAGGAAAAGATCGCCCTTTTGA
AGGACTTATTGCTAAGAGCTGTGGCAACACATCAGATAACACAGCTTGAAGGGGACCGAAGACA
GAACCTCTTGGATGATCTTGTAACTCGAGAGCGACTACTTCTGGCATCCTTTAAGAATGAGGGT
GCCGAACCAGATCTAATCAGGTCCAGCCTGATGAGTGAAGAGGCTAAGCGAGGAGCACCCAACC
CTTGGCTCTTTGAGGAGCCAGAGGAGACCAGAGGCTTGGGTTTTGATGAAATCCGGCAACAGCA
GCAGAAAATTATCCAAGAACAGGATGCAGGCCTTGATGCCCTTTCTTCCATCATAAGTCGCCAA
AAACAAATGGGGCAGGAAATTGGGAATGAATTGGATGAACAAAATGAGATAATTGACGACCTTG
CCAACCTGGTGGAGAACACAGATGAAAAACTTCGCACTGAAACCAGGCGTGTAAACCTGGTGGA
CAGAAAGTCAACCTCTTGTGGGATGATCATGGTGATTTTACTGCTGCTCGTGGCTATCGTGGTG
GTTGCGGTCTGGCCGACTAATTGATGGTGGTAAAGAAACCATCAGCTGTGACACCTGCCAGTGA
CAGATACAAGCCCAGCACCCTTTTGGTACGCAAAACCTGCTCTCAATAAATTCCCCCAAAGCTC
CGA

hide sequence

Protein Sequences


Protein RefSeqs	XP_008008521	(Get FASTA)	NCBI Sequence Viewer

RefSeq Acc Id:

XP_008008521 ⟸ XM_008010330

Additional Information

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	STX8	ENTREZGENE

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message

Imported Disease Annotations - ClinVar